ALKBH6 (NM_032878) Human Untagged Clone

SKU
SC317384
ALKBH6 (untagged)-Human alkB, alkylation repair homolog 6 (E. coli) (ALKBH6), transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol ALKBH6
Synonyms ABH6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC317384 representing NM_032878.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTGGGAGGGGGATGGGGATGTTGAATTTGGAAATTGGAGGGGACGCTGGTGGACGGATTGGGTGC
AAGGAGTTGGTGTTGATGGAGGAGCAGGACGCCAGAGTCCCAGCCCTGGAACCGTTCAGAGTGGAGCAG
GCACCACCTGTAATCTACTATGTCCCTGACTTCATCTCCAAAGAAGAGGAGGAGTATTTGCTTCGACAG
GTTTTTAATGCCCCAAAGCCAAAGTGGACCCAGCTCTCTGGGAGAAAGTTACAGAACTGGGGTGGGCTT
CCTCATCCCCGAGGGATGGTTCCTGAGCGGCTGCCCCCATGGCTCCAGCGCTACGTGGACAAAGTGTCA
AACCTCAGCCTCTTTGGAGGCCTCCCAGCTAACCATGTCCTCGTGAACCAGTATCTGCCTGGGGAGGGC
ATCATGCCCCACGAGGACGGACCACTGTACTACCCGACTGTCAGCACCATCAGCCTGGGCTCCCACACC
GTGCTGGACTTCTACGAGCCGCGGCGGCCAGAGGACGATGACCCTACAGAACAGCCTCGGCCTCCGCCC
CGGCCCACCACCTCGCTACTGCTGGAACCGCGCAGCCTGCTGGTGCTCCGCGGCCCCGCCTACACGCGT
CTTCTCCACGGCATCGCCGCCGCCCGCGTAGACGCGCTGGACGCCGCCTCCTCGCCGCCCAATGCGGCA
GCCTGCCCGTCGGCGCGGCCGGGAGCCTGCCTGGTGCGCGGCACCCGGGTCTCGCTGACCATCCGCCGC
GTGCCCCGCGTGCTGCGCGCCGGCCTCCTGCTGGGCAAGTGA

AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGAT
ATCCTGGATTACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-RsrII
ACCN NM_032878
Insert Size 801 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_032878.3
RefSeq Size 980 bp
RefSeq ORF 801 bp
Locus ID 84964
UniProt ID Q3KRA9
Cytogenetics 19q13.12
Domains 2OG-FeII_Oxy
MW 29.3 kDa
Summary Probable dioxygenase that requires molecular oxygen, alpha-ketoglutarate and iron.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) encodes the longest isoform (2).
Write Your Own Review
You're reviewing:ALKBH6 (NM_032878) Human Untagged Clone
Your Rating
SKU Description Size Price
RC224553 ALKBH6 (Myc-DDK-tagged)-Human alkB, alkylation repair homolog 6 (E. coli) (ALKBH6), transcript variant 2 10 ug
$300.00
RC224553L3 Lenti ORF clone of Human alkB, alkylation repair homolog 6 (E. coli) (ALKBH6), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC224553L4 Lenti ORF clone of Human alkB, alkylation repair homolog 6 (E. coli) (ALKBH6), transcript variant 2, mGFP tagged 10 ug
$600.00
RG224553 ALKBH6 (tGFP-tagged) - Human alkB, alkylation repair homolog 6 (E. coli) (ALKBH6), transcript variant 2 10 ug
$500.00
SC126718 ALKBH6 (untagged)-Human alkB, alkylation repair homolog 6 (E. coli) (ALKBH6), transcript variant 2 10 ug
$300.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.