C11orf48 (LBHD1) (NM_024099) Human Untagged Clone

SKU
SC317378
C11orf48 (untagged)-Human chromosome 11 open reading frame 48 (C11orf48)
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol C11orf48
Synonyms C11orf48
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC317378 representing NM_024099.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCCTTGTGCCAGGGAGAAGCAAGGAGGATGGGCTTTGGACTAGAAATAGCCCAGGCTCCTCCCAG
CATCCAGAAAGTCCCAGGCTGCCCAACCCTCTCTGGGACAGAGGAAAAATTGGCAAGGTTGAAGGTCAC
CAGCACATTCAGGATTTCTCTCAAAAGTCCCATCTGCCGTCTATTGTGGTGGAATCCAGTGAGGTGAAT
GAAGAGAGTGGGGATCTCCATTTGCCCCATGAGGAGCTGCTGCTGCTCACTGATGGTGAGGAAGAGGAT
GCTGAGGCCTTCTTCCAAGACCAAAGTGAAGAGCCAGGCTGGGCTTGGAGCCCACAGGACCCTAGAAGT
CCTTTAAGAACATTTAACGCTGGACTCAGCTGGGGGCAGGACCAGGATGAAGAAGATGCTTGTTGGATT
CTTGAGGACACAGCATGTCTGGAAGCCACCAACCACTGTCCCTTCTGGGACTCAACAGGCTCCCGTGTT
TGTAGAAGTGGCTTTGTGGAATATTCCCATCTCCTGCCTCCTAATAGCTTTGAGGGAGCTGAAGAAGAA
GCTGTTCAAACGCCGGCGGGTGTTGAATCGGGAGCGGCGTCTGAGGCACCGGGTGGTCGGGGCTGTGAT
AGACCAAGGGCTGATCACGCGGCACCACCTCAAGAAGCGGGCGTCCAGTGCACGTGCCAACATTACACT
GTCAGGGAAGAAGCGCAGAAAACTCCTCCAGCAGATCCGGCTTGCCCAGAAAGAGAAGACAGCCATGGA
AGTGGAAGCCCCTTCAAAGCCAGCCAGGACTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_024099
Insert Size 792 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_024099.3
RefSeq Size 1357 bp
RefSeq ORF 792 bp
Locus ID 79081
UniProt ID Q9BQE6
Cytogenetics 11q12.3
MW 28.8 kDa
Summary This gene shares three exons in common with another gene, chromosome 11 open reading frame 98 (GeneID:102288414), but the encoded protein uses a reading frame that is different from that of the chromosome 11 open reading frame 98 gene. [provided by RefSeq, Nov 2017]
Transcript Variant: This variant (2) lacks an alternate in-frame segment compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a. Variants 2 and 3 both encode the same isoform (b).
Write Your Own Review
You're reviewing:C11orf48 (LBHD1) (NM_024099) Human Untagged Clone
Your Rating
SKU Description Size Price
RC200782 C11orf48 (Myc-DDK-tagged)-Human chromosome 11 open reading frame 48 (C11orf48) 10 ug
$300.00
RC200782L3 Lenti ORF clone of Human chromosome 11 open reading frame 48 (C11orf48), Myc-DDK-tagged 10 ug
$600.00
RC200782L4 Lenti ORF clone of Human chromosome 11 open reading frame 48 (C11orf48), mGFP tagged 10 ug
$600.00
RG200782 C11orf48 (tGFP-tagged) - Human chromosome 11 open reading frame 48 (C11orf48) 10 ug
$489.00 MSRP $500.00 MSRP $500.00
SC320199 C11orf48 (untagged)-Human chromosome 11 open reading frame 48 (C11orf48) 10 ug
$300.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.