PCGF1 (NM_032673) Human Untagged Clone

SKU
SC317369
PCGF1 (untagged)-Human polycomb group ring finger 1 (PCGF1)
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PCGF1
Synonyms 2010002K04Rik; NSPC1; RNF3A-2; RNF68
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC317369 representing NM_032673.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTA
CCGAGGAGATCTGCCGCCGCGATCGCCGGCGCGCCC
ATGGCGTCTCCTCAGGGGGGCCAGATTGCGATCGCGATGAGGCTTCGGAACCAGCTCCAGTCAGTGTAC
AAGATGGACCCGCTACGGAACGAGGAGGAGGTTCGAGTGAAGATCAAAGACTTGAATGAACACATTGTT
TGCTGCCTATGCGCCGGCTACTTCGTGGATGCCACCACCATCACAGAGTGTCTTCATACTTTCTGCAAG
AGTTGTATTGTGAAGTACCTCCAAACTAGCAAGTACTGCCCCATGTGCAACATTAAGATCCACGAGACA
CAGCCACTGCTCAACCTCAAACTGGACCGGGTCATGCAGGACATCGTGTATAAGCTGGTGCCTGGCTTG
CAAGACAGTGAAGAGAAACGGATTCGGGAATTCTACCAGTCCCGAGGTTTGGACCGGGTCACCCAGCCC
ACTGGGGAAGAGCCAGCACTGAGCAACCTCGGCCTCCCCTTCAGCAGCTTTGACCACTCTAAAGCCCAC
TACTATCGCTATGATGAGCAGTTGAACCTGTGCCTGGAGCGGCTGAGTTCTGGCAAAGACAAGAATAAA
AGCGTCCTGCAGAACAAGTATGTCCGATGTTCTGTTAGAGCTGAGGTACGCCATCTCCGGAGGGTCCTG
TGTCACCGCTTGATGCTAAACCCTCAGCATGTGCAGCTCCTTTTTGACAATGAAGTTCTCCCTGATCAC
ATGACAATGAAGCAGATATGGCTCTCCCGCTGGTTCGGCAAGCCATCCCCTTTGCTTTTACAATACAGT
GTGAAAGAGAAGAGGAGGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites AscI-MluI
ACCN NM_032673
Insert Size 780 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_032673.2
RefSeq Size 939 bp
RefSeq ORF 780 bp
Locus ID 84759
UniProt ID Q9BSM1
Cytogenetics 2p13.1
Domains RING
MW 30.3 kDa
Summary PCGF1 is a mammalian homolog of the Drosophila polycomb group genes, which act as transcriptional repressors to regulate anterior-posterior patterning in early embryonic development (Nunes et al., 2001 [PubMed 11287196]). See also PCGF2 (MIM 600346).[supplied by OMIM, Aug 2008]
Write Your Own Review
You're reviewing:PCGF1 (NM_032673) Human Untagged Clone
Your Rating
SKU Description Size Price
RC216322 PCGF1 (Myc-DDK-tagged)-Human polycomb group ring finger 1 (PCGF1) 10 ug
$300.00
RC216322L1 Lenti ORF clone of Human polycomb group ring finger 1 (PCGF1), Myc-DDK-tagged 10 ug
$600.00
RC216322L2 Lenti ORF clone of Human polycomb group ring finger 1 (PCGF1), mGFP tagged 10 ug
$600.00
RC216322L3 Lenti ORF clone of Human polycomb group ring finger 1 (PCGF1), Myc-DDK-tagged 10 ug
$600.00
RC216322L4 Lenti ORF clone of Human polycomb group ring finger 1 (PCGF1), mGFP tagged 10 ug
$600.00
RG216322 PCGF1 (tGFP-tagged) - Human polycomb group ring finger 1 (PCGF1) 10 ug
$500.00
SC103969 PCGF1 (untagged)-Human polycomb group ring finger 1 (PCGF1) 10 ug
$300.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.