RGS20 (NM_003702) Human Untagged Clone

SKU
SC317344
RGS20 (untagged)-Human regulator of G-protein signaling 20 (RGS20), transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol RGS20
Synonyms g(z)GAP; gz-GAP; RGSZ1; ZGAP1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC317344 representing NM_003702.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCGCACGGCGGACGGAGGCGAGCCGGCCGGGGCTTCCTCCCCGGCCGGCAGGGTGGACGGTGGGCTC
CAGATGGGATCAGAGCGGATGGAGATGCGGAAGCGGCAGATGCCCGCCGCCCAGGACACACCAGGCGCC
GCCCCAGGCCAGCCCGGAGCGGGGAGTCGCGGGTCCAACGCATGCTGCTTCTGCTGGTGCTGCTGTTGT
AGCTGCTCGTGTCTCACTGTTAGAAACCAGGAAGATCAGAGGCCCACAATAGCTTCCCACGAACTCAGA
GCAGATCTTCCAACCTGGGAAGAAAGCCCTGCTCCTACTCTGGAAGAAGTCAACGCCTGGGCTCAGTCA
TTTGACAAATTAATGGTCACTCCAGCAGGAAGGAATGCATTCCGTGAATTCCTCCGAACAGAATTCAGT
GAGGAAAATATGCTCTTCTGGATGGCCTGTGAGGAACTGAAAAAGGAAGCTAATAAAAACATTATTGAA
GAGAAAGCAAGGATAATCTATGAAGACTACATTTCTATACTTTCTCCTAAGGAGGTGAGCTTAGACTCC
CGGGTGAGAGAAGTGATCAACAGAAACATGGTGGAGCCATCCCAACACATATTCGATGATGCTCAACTT
CAGATTTACACCCTGATGCACAGAGACTCATATCCTCGATTCATGAACTCTGCTGTCTATAAGGACTTG
CTTCAGTCCTTATCGGAGAAATCTATTGAAGCATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_003702
Insert Size 726 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_003702.4
RefSeq Size 1716 bp
RefSeq ORF 726 bp
Locus ID 8601
UniProt ID O76081
Cytogenetics 8q11.23
Domains RGS
Protein Families Druggable Genome
MW 27.1 kDa
Summary The protein encoded by this gene belongs to the family of regulator of G protein signaling (RGS) proteins, which are regulatory and structural components of G protein-coupled receptor complexes. RGS proteins inhibit signal transduction by increasing the GTPase activity of G protein alpha subunits, thereby driving them into their inactive GDP-bound forms. This protein selectively binds to G(z)-alpha and G(alpha)-i2 subunits, and regulates their signaling activities. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Transcript Variant: This variant (2) differs in the 5' UTR and 5' coding region compared to variant 1. The resulting isoform (b) has a shorter and distinct N-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:RGS20 (NM_003702) Human Untagged Clone
Your Rating
SKU Description Size Price
RC209495 RGS20 (Myc-DDK-tagged)-Human regulator of G-protein signaling 20 (RGS20), transcript variant 2 10 ug
$300.00
RC209495L3 Lenti ORF clone of Human regulator of G-protein signaling 20 (RGS20), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC209495L4 Lenti ORF clone of Human regulator of G-protein signaling 20 (RGS20), transcript variant 2, mGFP tagged 10 ug
$600.00
RG209495 RGS20 (tGFP-tagged) - Human regulator of G-protein signaling 20 (RGS20), transcript variant 2 10 ug
$489.00 MSRP $500.00 MSRP $500.00
SC117814 RGS20 (untagged)-Human regulator of G-protein signaling 20 (RGS20), transcript variant 2 10 ug
$300.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.