GRPEL2 (NM_152407) Human Untagged Clone

SKU
SC317326
GRPEL2 (untagged)-Human GrpE-like 2, mitochondrial (E. coli) (GRPEL2), nuclear gene encoding mitochondrial protein
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol GRPEL2
Synonyms Mt-GrpE#2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC317326 representing NM_152407.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCGTACGGTCGCTGTGGGCGGGCCGGCTGCGGGTGCAGCGCCTACTGGCCTGGAGTGCCGCGTGG
GAGAGCAAGGGATGGCCGCTTCCATTCAGCACTGCCACCCAGAGAACTGCTGGTGAGGACTGCCGTTCT
GAGGACCCTCCTGATGAGCTTGGGCCCCCTCTTGCTGAACGAGCCTTAAGGGTAAAAGCTGTTAAACTG
GAGAAAGAAGTCCAAGATTTAACAGTGAGATACCAGAGAGCTATAGCTGATTGTGAAAACATAAGGAGG
CGAACCCAGAGATGTGTGGAAGACGCCAAGATATTTGGAATCCAGAGTTTCTGTAAGGACTTGGTGGAG
GTGGCTGACATTTTGGAGAAGACTACAGAGTGCATTTCTGAAGAATCGGAGCCTGAGGACCAAAAGCTC
ACTCTGGAGAAGGTCTTCCGAGGGTTGTTGCTTTTAGAAGCAAAGCTGAAAAGTGTGTTTGCCAAGCAT
GGCCTGGAGAAACTGACACCCATTGGTGACAAATATGACCCCCATGAGCATGAACTCATCTGTCATGTG
CCAGCTGGTGTTGGGGTGCAGCCTGGCACCGTGGCATTAGTAAGACAAGATGGCTACAAACTTCATGGC
CGCACCATTAGGCTTGCCCGAGTGGAAGTGGCAGTGGAGTCTCAGAGAAGACTGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_152407
Insert Size 678 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_152407.3
RefSeq Size 4105 bp
RefSeq ORF 678 bp
Locus ID 134266
UniProt ID Q8TAA5
Cytogenetics 5q32
MW 25.4 kDa
Summary Essential component of the PAM complex, a complex required for the translocation of transit peptide-containing proteins from the inner membrane into the mitochondrial matrix in an ATP-dependent manner. Seems to control the nucleotide-dependent binding of mitochondrial HSP70 to substrate proteins. Stimulates ATPase activity of mt-HSP70. May also serve to modulate the interconversion of oligomeric (inactive) and monomeric (active) forms of mt-HSP70 (By similarity).[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:GRPEL2 (NM_152407) Human Untagged Clone
Your Rating
SKU Description Size Price
RC206315 GRPEL2 (Myc-DDK-tagged)-Human GrpE-like 2, mitochondrial (E. coli) (GRPEL2), nuclear gene encoding mitochondrial protein 10 ug
$300.00
RC206315L3 Lenti-ORF clone of GRPEL2 (Myc-DDK-tagged)-Human GrpE-like 2, mitochondrial (E. coli) (GRPEL2), nuclear gene encoding mitochondrial protein 10 ug
$600.00
RC206315L4 Lenti-ORF clone of GRPEL2 (mGFP-tagged)-Human GrpE-like 2, mitochondrial (E. coli) (GRPEL2), nuclear gene encoding mitochondrial protein 10 ug
$600.00
RG206315 GRPEL2 (tGFP-tagged) - Human GrpE-like 2, mitochondrial (E. coli) (GRPEL2), nuclear gene encoding mitochondrial protein 10 ug
$500.00
SC100585 GRPEL2 (untagged)-Human GrpE-like 2, mitochondrial (E. coli) (GRPEL2), nuclear gene encoding mitochondrial protein 10 ug
$150.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.