VTI1A (NM_145206) Human Untagged Clone

SKU
SC317321
VTI1A (untagged)-Human vesicle transport through interaction with t-SNAREs homolog 1A (yeast) (VTI1A)
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol VTI1A
Synonyms MMDS3; MVti1; Vti1-rp2; VTI1RP2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC317321 representing NM_145206.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCGTCCGACTTCGAAGGTTACGAGCAGGACTTCGCGGTGCTCACTGCAGAGATCACCAGCAAGATT
GCGAGGGTCCCACGACTCCCGCCTGATGAAAAGAAACAGATGGTTGCAAATGTGGAGAAACAGCTTGAA
GAAGCGAAAGAACTGCTTGAACAGATGGATTTGGAAGTCCGAGAGATACCACCCCAAAGTCGAGGGATG
TACAGCAACAGAATGAGAAGCTACAAACAAGAAATGGGAAAACTCGAAACAGATTTTAAAAGGTCACGG
ATCGCCTACAGTGACGAAGTACGGAATGAGCTCCTGGGGGATGATGGGAATTCCTCAGAGAACCAGAGG
GCACATCTGCTCGATAACACAGAGAGGCTGGAAAGGTCATCTCGGAGACTAGAGGCTGGATACCAAATA
GCAGTGGAAACCGAGCAAATTGGTCAGGAGATGTTGGAAAACCTTAGTCATGACAGAGAAAAGATACAG
CGAGCACGTGAAAGACTTCGGGAAACAGATGCTAATTTGGGAAAAAGCTCCAGGATTCTGACAGGGATG
TTGCGAAGAATCATCCAGAACCGCATCCTGCTCGTCATCCTAGGGATCATCGTGGTCATCACCATCCTG
ATGGCGATCACTTTTTCTGTCAGAAGACACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_145206
Insert Size 654 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_145206.3
RefSeq Size 4417 bp
RefSeq ORF 654 bp
Locus ID 143187
UniProt ID Q96AJ9
Cytogenetics 10q25.2
Domains V-SNARE
Protein Families Transmembrane
Protein Pathways SNARE interactions in vesicular transport
MW 25.2 kDa
Summary The protein encoded by this gene is a member of the family of soluble N-ethylmaleimide-sensitive fusion protein-attachment protein receptors (SNAREs) that function in intracellular trafficking. This family member is involved in vesicular transport between endosomes and the trans-Golgi network. It is a vesicle-associated SNARE (v-SNARE) that interacts with target membrane SNAREs (t-SNAREs). Polymorphisms in this gene have been associated with binocular function, and also with susceptibility to colorectal and lung cancers. A recurrent rearrangement has been found between this gene and the transcription factor 7-like 2 (TCF7L2) gene in colorectal cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the central coding region, compared to variant 1, resulting in an isoform (b) that is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:VTI1A (NM_145206) Human Untagged Clone
Your Rating
SKU Description Size Price
RC213934 VTI1A (Myc-DDK-tagged)-Human vesicle transport through interaction with t-SNAREs homolog 1A (yeast) (VTI1A) 10 ug
$300.00
RC213934L1 Lenti ORF clone of Human vesicle transport through interaction with t-SNAREs homolog 1A (yeast) (VTI1A), Myc-DDK-tagged 10 ug
$600.00
RC213934L2 Lenti ORF clone of Human vesicle transport through interaction with t-SNAREs homolog 1A (yeast) (VTI1A), mGFP tagged 10 ug
$600.00
RC213934L3 Lenti ORF clone of Human vesicle transport through interaction with t-SNAREs homolog 1A (yeast) (VTI1A), Myc-DDK-tagged 10 ug
$600.00
RC213934L4 Lenti ORF clone of Human vesicle transport through interaction with t-SNAREs homolog 1A (yeast) (VTI1A), mGFP tagged 10 ug
$600.00
RG213934 VTI1A (tGFP-tagged) - Human vesicle transport through interaction with t-SNAREs homolog 1A (yeast) (VTI1A) 10 ug
$489.00 MSRP $500.00 MSRP $500.00
SC309124 VTI1A (untagged)-Human vesicle transport through interaction with t-SNAREs homolog 1A (yeast) (VTI1A) 10 ug
$300.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.