Tartrate Resistant Acid Phosphatase (ACP5) (NM_001111034) Human Untagged Clone

SKU
SC317190
ACP5 (untagged)-Human acid phosphatase 5, tartrate resistant (ACP5), transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Tartrate Resistant Acid Phosphatase
Synonyms HPAP; TRACP5a; TRACP5b; TRAP; TrATPase
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC317190 representing NM_001111034.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGACATGTGGACGGCGCTGCTCATCCTGCAAGCCTTGTTGCTACCCTCCCTGGCTGATGGTGCCACC
CCTGCCCTGCGCTTTGTAGCCGTGGGTGACTGGGGAGGGGTCCCCAATGCCCCATTCCACACGGCCCGG
GAAATGGCCAATGCCAAGGAGATCGCTCGGACTGTGCAGATCCTGGGTGCAGACTTCATCCTGTCTCTA
GGGGACAATTTTTACTTCACTGGTGTGCAAGACATCAATGACAAGAGGTTCCAGGAGACCTTTGAGGAC
GTATTCTCTGACCGCTCCCTTCGCAAAGTGCCCTGGTACGTGCTAGCCGGAAACCATGACCACCTTGGC
AATGTCTCTGCCCAGATTGCATACTCTAAGATCTCCAAGCGCTGGAACTTCCCCAGCCCTTTCTACCGC
CTGCACTTCAAGATCCCACAGACCAATGTGTCTGTGGCCATTTTTATGCTGGACACAGTGACACTATGT
GGCAACTCAGATGACTTCCTCAGCCAGCAGCCTGAGAGGCCCCGAGACGTGAAGCTGGCCCGCACACAG
CTGTCCTGGCTCAAGAAACAGCTGGCGGCGGCCAGGGAGGACTACGTGCTGGTGGCTGGCCACTACCCC
GTGTGGTCCATAGCCGAGCACGGGCCTACCCACTGCCTGGTCAAGCAGCTACGGCCACTGCTGGCCACA
TACGGGGTCACTGCCTACCTGTGCGGCCACGATCACAATCTGCAGTACCTGCAAGATGAGAATGGCGTG
GGCTACGTGCTGAGTGGGGCTGGGAATTTCATGGACCCCTCAAAGCGGCACCAGCGCAAGGTCCCCAAC
GGCTATCTGCGCTTCCACTATGGGACTGAAGACTCACTGGGTGGCTTTGCCTATGTGGAGATCAGCTCC
AAAGAGATGACTGTCACTTACATCGAGGCCTCGGGCAAGTCCCTCTTTAAGACCAGGCTGCCGAGGCGA
GCCAGGCCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001111034
Insert Size 978 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001111034.2
RefSeq Size 1641 bp
RefSeq ORF 978 bp
Locus ID 54
UniProt ID P13686
Cytogenetics 19p13.2
Protein Families Druggable Genome
Protein Pathways Lysosome, Riboflavin metabolism
MW 36.6 kDa
Summary This gene encodes an iron containing glycoprotein which catalyzes the conversion of orthophosphoric monoester to alcohol and orthophosphate. It is the most basic of the acid phosphatases and is the only form not inhibited by L(+)-tartrate. [provided by RefSeq, Aug 2008]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1-5 encode the same protein.
Write Your Own Review
You're reviewing:Tartrate Resistant Acid Phosphatase (ACP5) (NM_001111034) Human Untagged Clone
Your Rating
SKU Description Size Price
RC225470 ACP5 (Myc-DDK-tagged)-Human acid phosphatase 5, tartrate resistant (ACP5), transcript variant 2 10 ug
$300.00
RC225470L3 Lenti-ORF clone of ACP5 (Myc-DDK-tagged)-Human acid phosphatase 5, tartrate resistant (ACP5), transcript variant 2 10 ug
$600.00
RC225470L4 Lenti-ORF clone of ACP5 (mGFP-tagged)-Human acid phosphatase 5, tartrate resistant (ACP5), transcript variant 2 10 ug
$600.00
RG225470 ACP5 (tGFP-tagged) - Human acid phosphatase 5, tartrate resistant (ACP5), transcript variant 2 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.