SLC25A36 (NM_001104647) Human Untagged Clone

SKU
SC317059
SLC25A36 (untagged)-Human solute carrier family 25, member 36 (SLC25A36), transcript variant 1
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SLC25A36
Synonyms PNC2
Vector pCMV6 series
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001104647, the custom clone sequence may differ by one or more nucleotides
ATGAGCCAGAGGGACACGCTGGTGCATCTGTTTGCCGGAGGATGTGGTGGTACAGTGGGA
GCTATTCTGACATGTCCACTGGAAGTTGTAAAAACACGACTGCAGTCATCTTCTGTGACG
CTTTATATTTCTGAAGTTCAGCTGAACACCATGGCTGGAGCCAGTGTCAACCGAGTAGTG
TCTCCCGGACCTCTTCATTGCCTAAAGGTGATCTTGGAAAAAGAAGGGCCTCGTTCCTTG
TTTAGAGGACTAGGCCCCAATTTAGTGGGGGTAGCCCCTTCCAGAGCAATATACTTTGCT
GCTTATTCAAACTGCAAGGAAAAGTTGAATGATGTATTTGATCCTGATTCTACCCAAGTA
CATATGATTTCAGCTGCAATGGCAGGTTTTACTGCAATCACAGCAACCAACCCCATTTGG
CTTATAAAGACTCGGTTACAGCTTGATGCAAGGAACCGCGGGGAAAGGCGAATGGGTGCT
TTTGAATGTGTTCGTAAAGTGTATCAGACAGATGGACTAAAAGGATTTTATAGGGGCATG
TCTGCTTCATATGCTGGTATATCAGAGACTGTTATCCATTTTGTTATTTATGAAAGTATA
AAACAAAAACTACTGGAATATAAGACTGCTTCTACAATGGAAAATGATGAAGAGTCTGTG
AAAGAAGCATCAGATTTTGTGGGAATGATGCTAGCTGCTGCCACCTCAAAAACTTGTGCC
ACAACTATAGCATATCCACATGAAGTTGTAAGAACAAGACTACGTGAAGAGGGAACAAAA
TACAGATCTTTTTTTCAGACTCTATCTTTGCTTGTTCAAGAAGAAGGTTATGGGTCTCTT
TATCGTGGTCTGACAACTCATCTAGTGAGACAGATTCCAAACACAGCCATTATGATGGCC
ACCTATGAATTGGTGGTTTACCTACTCAATGGA
Restriction Sites Please inquire
ACCN NM_001104647
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001104647.1, NP_001098117.1
RefSeq Size 4677 bp
RefSeq ORF 936 bp
Locus ID 55186
UniProt ID Q96CQ1
Cytogenetics 3q23
Protein Families Druggable Genome, Transmembrane
Summary Mitochondrial transporter that imports/exports pyrimidine nucleotides into and from mitochondria. Transports preferentially cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport mechanism. Also transports guanine but not adenine (deoxy)nucleotides. Is inhibited strongly by pyridoxal 5'-phosphate, 4,7-diphenyl-1,10-phenanthroline, tannic acid, and mercurials (mercury dichloride, Mersalyl acid, p-hydroxymercuribenzoate). Participates in mitochondrial genome maintenance, regulation of mitochondrial membrane potential and mitochondrial respiration.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:SLC25A36 (NM_001104647) Human Untagged Clone
Your Rating
SKU Description Size Price
RC225437 SLC25A36 (Myc-DDK-tagged)-Human solute carrier family 25, member 36 (SLC25A36), transcript variant 1 10 ug
$330.00
RC225437L3 Lenti-ORF clone of SLC25A36 (Myc-DDK-tagged)-Human solute carrier family 25, member 36 (SLC25A36), transcript variant 1 10 ug
$630.00
RC225437L4 Lenti-ORF clone of SLC25A36 (mGFP-tagged)-Human solute carrier family 25, member 36 (SLC25A36), transcript variant 1 10 ug
$630.00
RG225437 SLC25A36 (tGFP-tagged) - Human solute carrier family 25, member 36 (SLC25A36), transcript variant 1 10 ug
$530.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.