GJB6 (NM_001110221) Human Untagged Clone

SKU SC317048

GJB6 (untagged)-Human gap junction protein, beta 6, 30kDa (GJB6), transcript variant 4

Product Data

• Type: Human Untagged Clone
• Target Symbol: GJB6
• Synonyms: CX30; DFNA3; DFNA3B; DFNB1B; ECTD2; ED2; EDH; HED; HED2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC317048 representing NM_001110221.; Blue=Insert sequence Red=Cloning site Green=Tag(s); ; GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG; GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC; ATGGATTGGGGGACGCTGCACACTTTCATCGGGGGTGTCAACAAACACTCCACCAGCATCGGGAAGGTG; TGGATCACAGTCATCTTTATTTTCCGAGTCATGATCCTCGTGGTGGCTGCCCAGGAAGTGTGGGGTGAC; GAGCAAGAGGACTTCGTCTGCAACACACTGCAACCGGGATGCAAAAATGTGTGCTATGACCACTTTTTC; CCGGTGTCCCACATCCGGCTGTGGGCCCTCCAGCTGATCTTCGTCTCCACCCCAGCGCTGCTGGTGGCC; ATGCATGTGGCCTACTACAGGCACGAAACCACTCGCAAGTTCAGGCGAGGAGAGAAGAGGAATGATTTC; AAAGACATAGAGGACATTAAAAAGCAGAAGGTTCGGATAGAGGGGTCGCTGTGGTGGACGTACACCAGC; AGCATCTTTTTCCGAATCATCTTTGAAGCAGCCTTTATGTATGTGTTTTACTTCCTTTACAATGGGTAC; CACCTGCCCTGGGTGTTGAAATGTGGGATTGACCCCTGCCCCAACCTTGTTGACTGCTTTATTTCTAGG; CCAACAGAGAAGACCGTGTTTACCATTTTTATGATTTCTGCGTCTGTGATTTGCATGCTGCTTAACGTG; GCAGAGTTGTGCTACCTGCTGCTGAAAGTGTGTTTTAGGAGATCAAAGAGAGCACAGACGCAAAAAAAT; CACCCCAATCATGCCCTAAAGGAGAGTAAGCAGAATGAAATGAATGAGCTGATTTCAGATAGTGGTCAA; AATGCAATCACAGGTTTCCCAAGCTAA; ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT; TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC;
• Restriction Sites: SgfI-MluI
• ACCN: NM_001110221
• Insert Size: 786 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_001110221.2
• RefSeq Size: 1944 bp
• RefSeq ORF: 786 bp
• Locus ID: 10804
• UniProt ID: O95452
• Cytogenetics: 13q12.11
• Protein Families: Druggable Genome, Transmembrane
• MW: 30.4 kDa
• Summary: Gap junctions allow the transport of ions and metabolites between the cytoplasm of adjacent cells. They are formed by two hemichannels, made up of six connexin proteins assembled in groups. Each connexin protein has four transmembrane segments, two extracellular loops, a cytoplasmic loop formed between the two inner transmembrane segments, and the N- and C-terminus both being in the cytoplasm. The specificity of the gap junction is determined by which connexin proteins comprise the hemichannel. In the past, connexin protein names were based on their molecular weight, however the new nomenclature uses sequential numbers based on which form (alpha or beta) of the gap junction is present. This gene encodes one of the connexin proteins. Mutations in this gene have been found in some forms of deafness and in some families with hidrotic ectodermal dysplasia. [provided by RefSeq, Jul 2008]; Transcript Variant: This variant (4) lacks two 5' UTR segments, compared to variant 1. All variants encode the same protein.