NUDT7 (NM_001105663) Human Untagged Clone

SKU
SC317043
NUDT7 (untagged)-Human nudix (nucleoside diphosphate linked moiety X)-type motif 7 (NUDT7), transcript variant 1
$480.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol NUDT7
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC317043 representing NM_001105663.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCACGACTTGGTCTTCCCGAGGAGCCAGTCAGAAACAGTTTGCTAGATGATGCTAAGGCCCGCTTA
AGAAAGTATGATATTGGAGGCAAATATTCTCACTTGCCATATAACAAATACTCCGTCCTTTTGCCATTG
GTGGCTAAAGAAGGAAAACTCCATTTGTTGTTCACCGTCCGGTCAGAGAAGCTAAGAAGGGCCCCTGGA
GAAGTTTGCTTCCCTGGAGGTAAGCGTGACCCTACAGACATGGATGATGCAGCCACAGCTCTCCGGGAA
GCCCAGGAGGAAGTGGGTCTCCGTCCTCACCAAGTGGAAGTTGTCTGCTGCCTGGTGCCATGTCTTATT
GATACAGATACATTGATAACTCCATTTGTGGGTTTAATAGACCACAACTTCCAGGCCCAGCCGAATCCT
GCTGAAGTTAAGGATGTATTCCTGGTGCCTCTGGCCTATTTCCTGCATCCACAGGTCCATGACCAGCAT
TACGTCACACGTCTTGGTCACCGTTTTATTAATCATATCTTTGAGTACACAAACCCTGAAGACGGTGTC
ACTTACCAGATCAAGGGAATGACGGCAAACCTTGCAGTGTTGGTGGCCTTTATCATTTTGGAAAAAAAA
CCCACCTTTGAGGTTCAATTTAATCTTAATGATGTATTAGCATCCTCTGAAGAGTTATTCCTGAAGGTT
CATAAAAAAGCTACAAGCAGGTTATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001105663
Insert Size 717 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001105663.2
RefSeq Size 1118 bp
RefSeq ORF 717 bp
Locus ID 283927
UniProt ID P0C024
Cytogenetics 16q23.1
MW 26.9 kDa
Summary The protein encoded by this gene is a member of the Nudix hydrolase family. Nudix hydrolases eliminate potentially toxic nucleotide metabolites from the cell and regulate the concentrations and availability of many different nucleotide substrates, cofactors, and signaling molecules. Alternatively spliced transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (1) encodes the longest isoform (1).
Write Your Own Review
You're reviewing:NUDT7 (NM_001105663) Human Untagged Clone
Your Rating
SKU Description Size Price
RC225300 NUDT7 (Myc-DDK-tagged)-Human nudix (nucleoside diphosphate linked moiety X)-type motif 7 (NUDT7), transcript variant 1 10 ug
$450.00
RC225300L3 Lenti ORF clone of Human nudix (nucleoside diphosphate linked moiety X)-type motif 7 (NUDT7), transcript variant 1, Myc-DDK-tagged 10 ug
$750.00
RC225300L4 Lenti ORF clone of Human nudix (nucleoside diphosphate linked moiety X)-type motif 7 (NUDT7), transcript variant 1, mGFP tagged 10 ug
$750.00
RG225300 NUDT7 (tGFP-tagged) - Human nudix (nucleoside diphosphate linked moiety X)-type motif 7 (NUDT7), transcript variant 1 10 ug
$650.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.