NUDT7 (NM_001105663) Human Untagged Clone

SKU SC317043

NUDT7 (untagged)-Human nudix (nucleoside diphosphate linked moiety X)-type motif 7 (NUDT7), transcript variant 1

Product Data

• Type: Human Untagged Clone
• Target Symbol: NUDT7
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC317043 representing NM_001105663.; Blue=Insert sequence Red=Cloning site Green=Tag(s); ; GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG; GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC; ATGTCACGACTTGGTCTTCCCGAGGAGCCAGTCAGAAACAGTTTGCTAGATGATGCTAAGGCCCGCTTA; AGAAAGTATGATATTGGAGGCAAATATTCTCACTTGCCATATAACAAATACTCCGTCCTTTTGCCATTG; GTGGCTAAAGAAGGAAAACTCCATTTGTTGTTCACCGTCCGGTCAGAGAAGCTAAGAAGGGCCCCTGGA; GAAGTTTGCTTCCCTGGAGGTAAGCGTGACCCTACAGACATGGATGATGCAGCCACAGCTCTCCGGGAA; GCCCAGGAGGAAGTGGGTCTCCGTCCTCACCAAGTGGAAGTTGTCTGCTGCCTGGTGCCATGTCTTATT; GATACAGATACATTGATAACTCCATTTGTGGGTTTAATAGACCACAACTTCCAGGCCCAGCCGAATCCT; GCTGAAGTTAAGGATGTATTCCTGGTGCCTCTGGCCTATTTCCTGCATCCACAGGTCCATGACCAGCAT; TACGTCACACGTCTTGGTCACCGTTTTATTAATCATATCTTTGAGTACACAAACCCTGAAGACGGTGTC; ACTTACCAGATCAAGGGAATGACGGCAAACCTTGCAGTGTTGGTGGCCTTTATCATTTTGGAAAAAAAA; CCCACCTTTGAGGTTCAATTTAATCTTAATGATGTATTAGCATCCTCTGAAGAGTTATTCCTGAAGGTT; CATAAAAAAGCTACAAGCAGGTTATGA; ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT; TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC;
• Restriction Sites: SgfI-MluI
• ACCN: NM_001105663
• Insert Size: 717 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.; ; The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_001105663.2
• RefSeq Size: 1118 bp
• RefSeq ORF: 717 bp
• Locus ID: 283927
• UniProt ID: P0C024
• Cytogenetics: 16q23.1
• MW: 26.9 kDa
• Summary: The protein encoded by this gene is a member of the Nudix hydrolase family. Nudix hydrolases eliminate potentially toxic nucleotide metabolites from the cell and regulate the concentrations and availability of many different nucleotide substrates, cofactors, and signaling molecules. Alternatively spliced transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Aug 2011]; Transcript Variant: This variant (1) encodes the longest isoform (1).