PRH2 (NM_001110213) Human Untagged Clone

SKU
SC317036
PRH2 (untagged)-Human proline-rich protein HaeIII subfamily 2 (PRH2), transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PRH2
Synonyms Pr; pr1/Pr2; PRP-1/PRP-2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC317036 representing NM_001110213.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTTCTGATTCTGCTGTCAGTGGCCCTGCTGGCCTTCAGCTCAGCTCAGGACTTAGATGAAGATGTC
AGCCAAGAAGACGTTCCCTTGGTAATATCAGATGGAGGAGACTCTGAGCAGTTCATAGATGAGGAGCGT
CAGGGACCACCTTTGGGAGGACAGCAATCTCAACCCTCTGCTGGTGATGGGAACCAGAATGATGGCCCT
CAGCAGGGACCACCCCAACAAGGAGGCCAGCAGCAACAAGGTCCACCACCTCCTCAGGGAAAGCCACAA
GGACCACCCCAACAGGGAGGCCATCCCCCTCCTCCTCAAGGAAGGCCACAAGGACCACCCCAACAGGGA
GGCCATCCCCGTCCTCCTCGAGGAAGGCCACAAGGACCACCCCAACAGGGAGGCCATCAGCAAGGTCCT
CCCCCACCTCCTCCTGGAAAGCCCCAGGGACCACCTCCCCAAGGGGGCCGCCCACAAGGACCTCCACAG
GGGCAGTCTCCTCAGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001110213
Insert Size 501 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001110213.1
RefSeq Size 3177 bp
RefSeq ORF 501 bp
Locus ID 5555
UniProt ID P02810
Cytogenetics 12p13.2
Protein Families Secreted Protein
MW 17 kDa
Summary This gene encodes a member of the heterogeneous family of proline-rich salivary glycoproteins. The encoded preproprotein undergoes proteolytic processing to generate one or more mature isoforms before secretion from the parotid and submandibular/sublingual glands. In western population this locus is commonly biallelic and encodes proline-rich protein (PRP) isoforms, PRP-1 and PRP-2. The reference genome encodes the PRP-1 allele. Certain alleles of this gene are associated with susceptibility to dental caries. This gene is located in a cluster of closely related salivary proline-rich proteins on chromosome 12. [provided by RefSeq, Oct 2015]
Write Your Own Review
You're reviewing:PRH2 (NM_001110213) Human Untagged Clone
Your Rating
SKU Description Size Price
RC225161 PRH2 (Myc-DDK-tagged)-Human proline-rich protein HaeIII subfamily 2 (PRH2), transcript variant 2 10 ug
$150.00
RC225161L3 Lenti ORF clone of Human proline-rich protein HaeIII subfamily 2 (PRH2), transcript variant 2, Myc-DDK-tagged 10 ug
$450.00
RC225161L4 Lenti ORF clone of Human proline-rich protein HaeIII subfamily 2 (PRH2), transcript variant 2, mGFP tagged 10 ug
$450.00
RG225161 PRH2 (tGFP-tagged) - Human proline-rich protein HaeIII subfamily 2 (PRH2), transcript variant 2 10 ug
$350.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.