VSIG4 (NM_001100431) Human Untagged Clone

SKU
SC316719
VSIG4 (untagged)-Human V-set and immunoglobulin domain containing 4 (VSIG4), transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol VSIG4
Synonyms CRIg; Z39IG
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC316719 representing NM_001100431.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGGATCTTACTGGGCCTGCTACTCCTGGGGCACCTAACAGTGGACACTTATGGCCGTCCCATCCTG
GAAGTGCCAGAGAGTGTAACAGGACCTTGGAAAGGGGATGTGAATCTTCCCTGCACCTATGACCCCCTG
CAAGGCTACACCCAAGTCTTGGTGAAGTGGCTGGTACAACGTGGCTCAGACCCTGTCACCATCTTTCTA
CGTGACTCTTCTGGAGACCATATCCAGCAGGCAAAGTACCAGGGCCGCCTGCATGTGAGCCACAAGGTT
CCAGGAGATGTATCCCTCCAATTGAGCACCCTGGAGATGGATGACCGGAGCCACTACACGTGTGAAGTC
ACCTGGCAGACTCCTGATGGCAACCAAGTCGTGAGAGATAAGATTACTGAGCTCCGTGTCCAGAAACAC
TCCTCAAAGCTACTCAAGACCAAGACTGAGGCACCTACAACCATGACATACCCCTTGAAAGCAACATCT
ACAGTGAAGCAGTCCTGGGACTGGACCACTGACATGGATGGCTACCTTGGAGAGACCAGTGCTGGGCCA
GGAAAGAGCCTGCCTGTCTTTGCCATCATCCTCATCATCTCCTTGTGCTGTATGGTGGTTTTTACCATG
GCCTATATCATGCTCTGTCGGAAGACATCCCAACAAGAGCATGTCTACGAAGCAGCCAGGGCACATGCC
AGAGAGGCCAACGACTCTGGAGAAACCATGAGGGTGGCCATCTTCGCAAGTGGCTGCTCCAGTGATGAG
CCAACTTCCCAGAATCTGGGCAACAACTACTCTGATGAGCCCTGCATAGGACAGGAGTACCAGATCATC
GCCCAGATCAATGGCAACTACGCCCGCCTGCTGGACACAGTTCCTCTGGATTATGAGTTTCTGGCCACT
GAGGGCAAAAGTGTCTGTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001100431
Insert Size 918 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001100431.1
RefSeq Size 1586 bp
RefSeq ORF 918 bp
Locus ID 11326
UniProt ID Q9Y279
Cytogenetics Xq12
Protein Families Transmembrane
MW 33.9 kDa
Summary This gene encodes a v-set and immunoglobulin-domain containing protein that is structurally related to the B7 family of immune regulatory proteins. The encoded protein may be a negative regulator of T-cell responses. This protein is also a receptor for the complement component 3 fragments C3b and iC3b. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Transcript Variant: This variant (2), also known as CRIg(S), lacks an alternate in-frame segment compared to variant 1, resulting in a shorter isoform (2), compared to isoform 1.
Write Your Own Review
You're reviewing:VSIG4 (NM_001100431) Human Untagged Clone
Your Rating
SKU Description Size Price
RC218106 VSIG4 (Myc-DDK-tagged)-Human V-set and immunoglobulin domain containing 4 (VSIG4), transcript variant 2 10 ug
$300.00
RC218106L1 Lenti ORF clone of Human V-set and immunoglobulin domain containing 4 (VSIG4), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC218106L2 Lenti ORF clone of Human V-set and immunoglobulin domain containing 4 (VSIG4), transcript variant 2, mGFP tagged 10 ug
$600.00
RC218106L3 Lenti ORF clone of Human V-set and immunoglobulin domain containing 4 (VSIG4), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC218106L4 Lenti ORF clone of Human V-set and immunoglobulin domain containing 4 (VSIG4), transcript variant 2, mGFP tagged 10 ug
$600.00
RG218106 VSIG4 (tGFP-tagged) - Human V-set and immunoglobulin domain containing 4 (VSIG4), transcript variant 2 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.