MMD2 (NM_001100600) Human Untagged Clone

SKU
SC316697
MMD2 (untagged)-Human monocyte to macrophage differentiation-associated 2 (MMD2), transcript variant 1
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MMD2
Synonyms PAQR10
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC316697 representing NM_001100600.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTTCGCCCCCCGGCTGCTGGATTTCCAGAAGACGAAATACGCGAGGTTCATGAACCACCGAGTCCCT
GCCCACAAGAGGTACCAGCCCACAGAGTATGAACATGCGGCCAACTGTGCCACCCATGCTTTCTGGATC
ATCCCCAGCATCCTGGGCAGCTCCAACCTCTACTTCCTGTCGGACGATGACTGGGAGACCATCTCTGCC
TGGATCTACGGCCTCGGCCTCTGCGGCCTCTTCGTGGTGTCCACTGTGTTTCACACCATCTCCTGGAAG
AAGAGCCACCTCAGGATGGTGGAACACTGTCTACACATGTTCGACCGGATGGTCATCTATTTCTTCATA
GCGGCTTCCTACGCACCCTGGCTGAACCTTCGGGAGCTGGGCCCCTGGGCCTCCCACATGCGCTGGCTG
GTCTGGATTATGGCTTCCGTGGGCACCATCTATGTCTTCTTCTTCCATGAGCGAACAGGGAGCTGTGTG
CAGTTTCTTCGTGGGGAGGCATGTCCTAAGGCCGGCACGGCTTGTCTTCCTGCCAGGTACAAGCTTGTG
GAGCTTCTCTGCTACGTCGTAATGGGCTTCTTCCCCGCCCTGGTCATCCTCTCCATGCCCAACACCGAG
GGCATCTGGGAGCTGGTGACCGGAGGGGTCTTCTACTGCCTGGGCATGGTCTTCTTCAAGAGTGACGGG
AGGATCCCCTTTGCCCACGCCATCTGGCATCTCTTTGTAGCATTTGGTGCTGGTACCCACTACTATGCC
ATCTGGAGGTACCTCTATCTGCCCAGCACCCTGCAGACCAAGGTGTCCAAATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001100600
Insert Size 813 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001100600.1
RefSeq Size 2434 bp
RefSeq ORF 813 bp
Locus ID 221938
UniProt ID Q8IY49
Cytogenetics 7p22.1
Protein Families Druggable Genome, Transmembrane
MW 31.3 kDa
Summary This gene encodes a member of the PAQR (progestin and adipoQ receptor) family. Members of this family are evolutionarily conserved with significant sequence identity to bacterial hemolysin-like proteins and are defined by a set of seven transmembrane domains. The protein encoded by this gene localizes to the Golgi apparatus to modulate Ras signaling. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jun 2012]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).
Write Your Own Review
You're reviewing:MMD2 (NM_001100600) Human Untagged Clone
Your Rating
SKU Description Size Price
RC216026 MMD2 (Myc-DDK-tagged)-Human monocyte to macrophage differentiation-associated 2 (MMD2), transcript variant 1 10 ug
$289.00 MSRP $300.00 MSRP $300.00
RC216026L1 Lenti ORF clone of Human monocyte to macrophage differentiation-associated 2 (MMD2), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC216026L2 Lenti ORF clone of Human monocyte to macrophage differentiation-associated 2 (MMD2), transcript variant 1, mGFP tagged 10 ug
$600.00
RC216026L3 Lenti ORF clone of Human monocyte to macrophage differentiation-associated 2 (MMD2), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC216026L4 Lenti ORF clone of Human monocyte to macrophage differentiation-associated 2 (MMD2), transcript variant 1, mGFP tagged 10 ug
$600.00
RG216026 MMD2 (tGFP-tagged) - Human monocyte to macrophage differentiation-associated 2 (MMD2), transcript variant 1 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.