TMEM91 (NM_001098821) Human Untagged Clone

SKU
SC316667
TMEM91 (untagged)-Human transmembrane protein 91 (TMEM91), transcript variant 1
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol TMEM91
Synonyms DSPC3; IFITMD6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC316667 representing NM_001098821.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGACAGCCCTAGTCTTCGTGAGCTTCAACAGCCTCTGCTGGAGGGCACAGAATGTGAGACCCCTGCC
CAGAAGCCTGGCAGGCATGAGCTGGGGTCCCCCTTAAGAGAGATAGCCTTTGCCGAGTCCCTGAGGGGT
TTGCAGTTCCTGTCACCGCCTCTTCCCTCCGTGAGCGCTGGCCTGGGGGAACCAAGGCCCCCTGATGTT
GAGGACATGTCATCCAGTGACAGTGACTCGGACTGGGATGGAGGCAGCCGTCTTTCACCATTTCTACCC
CACGACCACCTCGGCTTGGCTGTCTTCTCCATGCTGTGTTGTTTCTGGCCCGTTGGCATCGCTGCCTTC
TGTCTAGCCCAGAAGACCAACAAGGCTTGGGCCAAGGGGGACATCCAGGGGGCAGGGGCCGCCTCCCGC
CGTGCCTTCCTGCTGGGGGTCCTCGCCGTCGGGCTGGGCGTGTGCACGTATGCGGCTGCCCTGGTGACC
CTGGCTGCCTACCTTGCCTCCCGAGACCCGCCCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001098821
Insert Size 519 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001098821.1
RefSeq Size 1091 bp
RefSeq ORF 519 bp
Locus ID 641649
UniProt ID Q6ZNR0
Cytogenetics 19q13.2
Protein Families Transmembrane
MW 18.2 kDa
Write Your Own Review
You're reviewing:TMEM91 (NM_001098821) Human Untagged Clone
Your Rating
SKU Description Size Price
RC218672 TMEM91 (Myc-DDK-tagged)-Human transmembrane protein 91 (TMEM91), transcript variant 1 10 ug
$300.00
RC218672L3 Lenti ORF clone of Human transmembrane protein 91 (TMEM91), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC218672L4 Lenti ORF clone of Human transmembrane protein 91 (TMEM91), transcript variant 1, mGFP tagged 10 ug
$600.00
RG218672 TMEM91 (tGFP-tagged) - Human transmembrane protein 91 (TMEM91), transcript variant 1 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.