DEP1 (PTPRJ) (NM_001098503) Human Untagged Clone

SKU
SC316400
PTPRJ (untagged)-Human protein tyrosine phosphatase, receptor type, J (PTPRJ), transcript variant 2
$804.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol DEP1
Synonyms CD148; DEP1; HPTPeta; R-PTP-ETA; SCC1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC316400 representing NM_001098503.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAGCCGGCGGCGCGGGAGGCGCGGCTGCCTCCGCGCTCGCCCGGGCTGCGCTGGGCGCTGCCGCTG
CTGCTGCTGCTGCTGCGCCTGGGCCAGATCCTGTGCGCAGGTGGCACCCCTAGTCCAATTCCTGACCCT
TCAGTAGCAACTGTTGCCACAGGGGAAAATGGCATAACGCAGATCAGCAGTACAGCAGAATCCTTTCAT
AAACAGAATGGAACTGGAACACCTCAGGTGGAAACAAACACCAGTGAGGATGGTGAAAGCTCTGGAGCC
AACGATAGTTTAAGAACACCTGAACAAGGATCTAATGGGACTGATGGGGCATCTCAAAAAACTCCCAGT
AGCACTGGGCCCAGTCCTGTGTTTGACATTAAAGCTGTTTCCATCAGTCCAACCAATGTGATCTTAACT
TGGAAAAGTAATGACACAGCTGCTTCTGAGTACAAGTATGTAGTAAAGCATAAGATGGAAAATGAGAAG
ACAATTACTGTTGTGCATCAACCATGGTGTAACATCACAGGCTTACGTCCAGCGACTTCATATGTATTC
TCCATCACTCCAGGAATAGGCAATGAGACTTGGGGAGATCCCAGAGTCATAAAAGTCATCACAGAGCCG
ATCCCAGTTTCTGATCTCCGTGTTGCCCTCACGGGTGTGAGGAAGGCTGCTCTCTCCTGGAGCAATGGC
AATGGCACTGCCTCCTGCCGGGTTCTTCTTGAAAGCATTGGAAGCCATGAGGAGTTGACTCAAGACTCA
AGACTTCAGGTCAATATCTCGGGCCTGAAGCCAGGGGTTCAATACAACATCAACCCGTATCTTCTACAA
TCAAATAAGACAAAGGGAGACCCCTTGGGCACAGAAGGTGGCTTGGATGCCAGCAATACAGAGAGAAGC
CGGGCAGGGAGCCCCACCGCCCCTGTGCATGATGAGTCCCTCGTGGGACCTGTGGACCCATCCTCCGGC
CAGCAGTCCCGAGACACGGAAGTCCTGCTTGTCGGGTTAGAGCCTGGCACCCGATACAATGCCACCGTT
TATTCCCAAGCAGCGAATGGCACAGAAGGACAGCCCCAGGCCATAGAGTTCAGGACAAATGCTATTCAG
GTTTTTGACGTCACCGCTGTGAACATCAGTGCCACAAGCCTGACCCTGATCTGGAAAGTCAGCGATAAC
GAGTCGTCATCTAACTATACCTACAAGATACATGTGGCGGGGGAGACAGATTCTTCCAATCTCAACGTC
AGTGAGCCTCGCGCTGTCATCCCCGGACTCCGCTCCAGCACCTTCTACAACATCACAGTGTGTCCTGTC
CTAGGTGACATCGAGGGCACGCCGGGCTTCCTCCAAGTGCACACCCCCCCTGTTCCAGTTTCTGACTTC
CGAGTGACAGTGGTCAGCACGACGGAGATCGGCTTAGCATGGAGCAGCCATGATGCAGAATCATTTCAG
ATGCATATCACACAGGAGGGAGCTGGCAATTCTCGGGTAGAAATAACCACCAACCAAAGTATTATCATT
GGTGGCTTGTTCCCTGGAACCAAGTATTGCTTTGAAATAGTTCCAAAAGGACCAAATGGGACTGAAGGG
GCATCTCGGACAGTTTGCAATAGAACTGGATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001098503
Insert Size 1620 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001098503.1
RefSeq Size 3193 bp
RefSeq ORF 1620 bp
Locus ID 5795
UniProt ID Q12913
Cytogenetics 11p11.2
Protein Families Druggable Genome, Phosphatase, Transmembrane
Protein Pathways Adherens junction
MW 57.2 kDa
Summary The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes, including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region containing five fibronectin type III repeats, a single transmembrane region, and a single intracytoplasmic catalytic domain, and thus represents a receptor-type PTP. This protein is present in all hematopoietic lineages, and was shown to negatively regulate T cell receptor signaling possibly through interfering with the phosphorylation of Phospholipase C Gamma 1 and Linker for Activation of T Cells. This protein can also dephosphorylate the PDGF beta receptor, and may be involved in UV-induced signal transduction. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) has multiple differences in the presence and absence of exons at its 3' end, compared to variant 1. These differences produce a unique 3' UTR, compared to variant 1, and the encoded protein (isoform 2) is shorter than isoform 1.
Write Your Own Review
You're reviewing:DEP1 (PTPRJ) (NM_001098503) Human Untagged Clone
Your Rating
SKU Description Size Price
RC211673 PTPRJ (Myc-DDK-tagged)-Human protein tyrosine phosphatase, receptor type, J (PTPRJ), transcript variant 2 10 ug
$752.00
RC211673L1 Lenti-ORF clone of PTPRJ (Myc-DDK-tagged)-Human protein tyrosine phosphatase, receptor type, J (PTPRJ), transcript variant 2 10 ug
$1,052.00
RC211673L2 Lenti-ORF clone of PTPRJ (mGFP-tagged)-Human protein tyrosine phosphatase, receptor type, J (PTPRJ), transcript variant 2 10 ug
$1,052.00
RC211673L3 Lenti-ORF clone of PTPRJ (Myc-DDK-tagged)-Human protein tyrosine phosphatase, receptor type, J (PTPRJ), transcript variant 2 10 ug
$1,052.00
RC211673L4 Lenti-ORF clone of PTPRJ (mGFP-tagged)-Human protein tyrosine phosphatase, receptor type, J (PTPRJ), transcript variant 2 10 ug
$1,052.00
RG211673 PTPRJ (tGFP-tagged) - Human protein tyrosine phosphatase, receptor type, J (PTPRJ), transcript variant 2 10 ug
$952.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.