MET (NM_000245) Human Untagged Clone

CAT#: SC316318

Reviews ()
Write a review

MET (untagged)-Human met proto-oncogene (hepatocyte growth factor receptor) (MET), transcript variant 2

 Cited in 4 publications.

  View "NM_000245" in other vectors (20)

Reward yourself with an Amazon® Card when get any 3 cDNA clones.

USD 1,070.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name MET (NM_000245) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol MET
Synonyms AUTS9; c-Met; DFNB97; HGFR; RCCP2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_000245 edited
ATGAAGGCCCCCGCTGTGCTTGCACCTGGCATCCTCGTGCTCCTGTTTACCTTGGTGCAG
AGGAGCAATGGGGAGTGTAAAGAGGCACTAGCAAAGTCCGAGATGAATGTGAATATGAAG
TATCAGCTTCCCAACTTCACCGCGGAAACACCCATCCAGAATGTCATTCTACATGAGCAT
CACATTTTCCTTGGTGCCACTAACTACATTTATGTTTTAAATGAGGAAGACCTTCAGAAG
GTTGCTGAGTACAAGACTGGGCCTGTGCTGGAACACCCAGATTGTTTCCCATGTCAGGAC
TGCAGCAGCAAAGCCAATTTATCAGGAGGTGTTTGGAAAGATAACATCAACATGGCTCTA
GTTGTCGACACCTACTATGATGATCAACTCATTAGCTGTGGCAGCGTCAACAGAGGGACC
TGCCAGCGACATGTCTTTCCCCACAATCATACTGCTGACATACAGTCGGAGGTTCACTGC
ATATTCTCCCCACAGATAGAAGAGCCCAGCCAGTGTCCTGACTGTGTGGTGAGCGCCCTG
GGAGCCAAAGTCCTTTCATCTGTAAAGGACCGGTTCATCAACTTCTTTGTAGGCAATACC
ATAAATTCTTCTTATTTCCCAGATCATCCATTGCATTCGATATCAGTGAGAAGGCTAAAG
GAAACGAAAGATGGTTTTATGTTTTTGACGGACCAGTCCTACATTGATGTTTTACCTGAG
TTCAGAGATTCTTACCCCATTAAGTATGTCCATGCCTTTGAAAGCAACAATTTTATTTAC
TTCTTGACGGTCCAAAGGGAAACTCTAGATGCTCAGACTTTTCACACAAGAATAATCAGG
TTCTGTTCCATAAACTCTGGATTGCATTCCTACATGGAAATGCCTCTGGAGTGTATTCTC
ACAGAAAAGAGAAAAAAGAGATCCACAAAGAAGGAAGTGTTTAATATACTTCAGGCTGCG
TATGTCAGCAAGCCTGGGGCCCAGCTTGCTAGACAAATAGGAGCCAGCCTGAATGATGAC
ATTCTTTTCGGGGTGTTCGCACAAAGCAAGCCAGATTCTGCCGAACCAATGGATCGATCT
GCCATGTGTGCATTCCCTATCAAATATGTCAACGACTTCTTCAACAAGATCGTCAACAAA
AACAATGTGAGATGTCTCCAGCATTTTTACGGACCCAATCATGAGCACTGCTTTAATAGG
ACACTTCTGAGAAATTCATCAGGCTGTGAAGCGCGCCGTGATGAATATCGAACAGAGTTT
ACCACAGCTTTGCAGCGCGTTGACTTATTCATGGGTCAATTCAGCGAAGTCCTCTTAACA
TCTATATCCACCTTCATTAAAGGAGACCTCACCATAGCTAATCTTGGGACATCAGAGGGT
CGCTTCATGCAGGTTGTGGTTTCTCGATCAGGACCATCAACCCCTCATGTGAATTTTCTC
CTGGACTCCCATCCAGTGTCTCCAGAAGTGATTGTGGAGCATACATTAAACCAAAATGGC
TACACACTGGTTATCACTGGGAAGAAGATCACGAAGATCCCATTGAATGGCTTGGGCTGC
AGACATTTCCAGTCCTGCAGTCAATGCCTCTCTGCCCCACCCTTTGTTCAGTGTGGCTGG
TGCCACGACAAATGTGTGCGATCGGAGGAATGCCTGAGCGGGACATGGACTCAACAGATC
TGTCTGCCTGCAATCTACAAGGTTTTCCCAAATAGTGCACCCCTTGAAGGAGGGACAAGG
CTGACCATATGTGGCTGGGACTTTGGATTTCGGAGGAATAATAAATTTGATTTAAAGAAA
ACTAGAGTTCTCCTTGGAAATGAGAGCTGCACCTTGACTTTAAGTGAGAGCACGATGAAT
ACATTGAAATGCACAGTTGGTCCTGCCATGAATAAGCATTTCAATATGTCCATAATTATT
TCAAATGGCCACGGGACAACACAATACAGTACATTCTCCTATGTGGATCCTGTAATAACA
AGTATTTCGCCGAAATACGGTCCTATGGCTGGTGGCACTTTACTTACTTTAACTGGAAAT
TACCTAAACAGTGGGAATTCTAGACACATTTCAATTGGTGGAAAAACATGTACTTTAAAA
AGTGTGTCAAACAGTATTCTTGAATGTTATACCCCAGCCCAAACCATTTCAACTGAGTTT
GCTGTTAAATTGAAAATTGACTTAGCCAACCGAGAGACAAGCATCTTCAGTTACCGTGAA
GATCCCATTGTCTATGAAATTCATCCAACCAAATCTTTTATTAGTGGTGGGAGCACAATA
ACAGGTGTTGGGAAAAACCTGAATTCAGTTAGTGTCCCGAGAATGGTCATAAATGTGCAT
GAAGCAGGAAGGAACTTTACAGTGGCATGTCAACATCGCTCTAATTCAGAGATAATCTGT
TGTACCACTCCTTCCCTGCAACAGCTGAATCTGCAACTCCCCCTGAAAACCAAAGCCTTT
TTCATGTTAGATGGGATCCTTTCCAAATACTTTGATCTCATTTATGTACATAATCCTGTG
TTTAAGCCTTTTGAAAAGCCAGTGATGATCTCAATGGGCAATGAAAATGTACTGGAAATT
AAGGGAAATGATATTGACCCTGAAGCAGTTAAAGGTGAAGTGTTAAAAGTTGGAAATAAG
AGCTGTGAGAATATACACTTACATTCTGAAGCCGTTTTATGCACGGTCCCCAATGACCTG
CTGAAATTGAACAGCGAGCTAAATATAGAGTGGAAGCAAGCAATTTCTTCAACCGTCCTT
GGAAAAGTAATAGTTCAACCAGATCAGAATTTCACAGGATTGATTGCTGGTGTTGTCTCA
ATATCAACAGCACTGTTATTACTACTTGGGTTTTTCCTGTGGCTGAAAAAGAGAAAGCAA
ATTAAAGATCTGGGCAGTGAATTAGTTCGCTACGATGCAAGAGTACACACTCCTCATTTG
GATAGGCTTGTAAGTGCCCGAAGTGTAAGCCCAACTACAGAAATGGTTTCAAATGAATCT
GTAGACTACCGAGCTACTTTTCCAGAAGATCAGTTTCCTAATTCATCTCAGAACGGTTCA
TGCCGACAAGTGCAGTATCCTCTGACAGACATGTCCCCCATCCTAACTAGTGGGGACTCT
GATATATCCAGTCCATTACTGCAAAATACTGTCCACATTGACCTCAGTGCTCTAAATCCA
GAGCTGGTCCAGGCAGTGCAGCATGTAGTGATTGGGCCCAGTAGCCTGATTGTGCATTTC
AATGAAGTCATAGGAAGAGGGCATTTTGGTTGTGTATATCATGGGACTTTGTTGGACAAT
GATGGCAAGAAAATTCACTGTGCTGTGAAATCCTTGAACAGAATCACTGACATAGGAGAA
GTTTCCCAATTTCTGACCGAGGGAATCATCATGAAAGATTTTAGTCATCCCAATGTCCTC
TCGCTCCTGGGAATCTGCCTGCGAAGTGAAGGGTCTCCGCTGGTGGTCCTACCATACATG
AAACATGGAGATCTTCGAAATTTCATTCGAAATGAGACTCATAATCCAACTGTAAAAGAT
CTTATTGGCTTTGGTCTTCAAGTAGCCAAAGGCATGAAATATCTTGCAAGCAAAAAGTTT
GTCCACAGAGACTTGGCTGCAAGAAACTGTATGCTGGATGAAAAATTCACAGTCAAGGTT
GCTGATTTTGGTCTTGCCAGAGACATGTATGATAAAGAATACTATAGTGTACACAACAAA
ACAGGTGCAAAGCTGCCAGTGAAGTGGATGGCTTTGGAAAGTCTGCAAACTCAAAAGTTT
ACCACCAAGTCAGATGTGTGGTCCTTTGGCGTGCTCCTCTGGGAGCTGATGACAAGAGGA
GCCCCACCTTATCCTGATGTAAACACCTTTGATATAACTGTTTACTTGTTGCAAGGGAGA
AGACTCCTACAACCCGAATACTGCCCAGACCCCTTATATGAAGTAATGCTAAAATGCTGG
CACCCTAAAGCCGAAATGCGCCCATCCTTTTCTGAACTGGTGTCCCGGATATCAGCAATC
TTCTCTACTTTCATTGGGGAGCACTATGTCCATGTGAACGCTACTTATGTGAACGTAAAA
TGTGTCGCTCCATATCCTTCTCTGTTGTCATCAGAAGATAACGCTGATGATGAGGTGGAC
ACACGACCAGCCTCCTTCTGGGAGACATCATAG
>OriGene 5' read for NM_000245 unedited
GAGACTTTGTATACGACTCCTATAGGGCGGCCGCGAATCTCGGCACCAGCTGACTTGCTG
AGAGGAGGCGGGGAGGCGCGGAGCGCGCGTGTGGTCCTTGCGCCGCTGACTTCTCCACTG
GTTCCTGGGCACCGAAAGATAAACCTCTCATAATGAAGGCCCCCGCTGTGCTTGCACCTG
GCATCCTCGTGCTCCTGTTTACCTTGGTGCAGAGGAGCAATGGGGAGTGTAAAGAGGCAC
TAGCAAAGTCCGAGATGAATGTGAATATGAAGTATCAGCTTCCCAACTTCACCGCGGAAA
CACCCATCCAGAATGTCATTCTACATGAGCATCACATTTTCCTTGGTGCCACTAACTACA
TTTATGTTTTAAATGAGGAAGACCTTCAGAAGGTTGCTGAGTACAAGACTGGGCCTGTGC
TGGAACACCCAGATTGTTTCCCATGTCAGGACTGCAGCAGCAAAGCCAATTTATCAGGAG
GTGTTTGGAAAGATAACATCAACATGGCTCTAGTTGTCGACACCTACTATGATGATCAAC
TCATTAGCTGTGGCAGCGTCAACAGAGGGACCTGCCAGCGACATGTCTTTCCCCACAATC
ATACTGCTGACATACAGTCGGAGGTTCACTGCATATTCTCCCCACAGATAGAAGAGCCCA
GCCAGTGTCCTGACTGTGTGGTGAGCGCCCTGGGAGCCAAAGTCCTTTCATCTGTAAAGG
ACCGGTTCATCAACTTCTTTGTAGGCAATACCATAAATTCTTCTTATTTCCCAGATCATC
CATTGCATTCGATATCAGTGAGACGCTAAAGAAACGAAAGATGGTTTTATGTTTTTGACG
GACCAGTCCTACATTGATGTTTTACCTGGAGTTCAGAGGATTTCTTACCCCATTAAGTAT
TG
>Forward primer walk for NM_000245 unedited
CTGCCATGCTGTGAAATTACAGTCAGGTTGCTGATTTTGGTCTTGCCAGAGACATGTATG
ATAAAGAATACTATAGTGTACACAACAAAACAGGTGCAAAGCTGCCAGTGAAGTGGATGG
CTTTGGAAAGTCTGCAAACTCAAAAGTTTACCACCAAGTCAGATGTGTGGTCCTTTGGCG
TGCTCCTCTGGGAGCTGATGACAAGAGGAGCCCCACCTTATCCTGATGTAAACACCTTTG
ATATAACTGTTTACTTGTTGCAAGGGAGAAGACTCCTACAACCCGAATACTGCCCAGACC
CCTTATATGAAGTAATGCTAAAATGCTGGCACCCTAAAGCCGAAATGCGCCCATCCTTTT
CTGAACTGGTGTCCCGGATATCAGCAATCTTCTCTACTTTCATTGGGGAGCACTATGTCC
ATGTGAACGCTACTTATGTGAACGTAAAATGTGTCGCTCCATATCCTTCTCTGTTGTCAT
CAGAAGATAACGCTGATGATGAGGTGGACACACGACCAGCCTCCTTCTGGGAGACATCAT
AGTGCTAGTACTATGTCAAAGCAACAGTCCACACTTTGTCCAATGGTTTTTTCACTGCCT
GACCTTTAAAAGGCCATCGATATTCTTTGCTCTTGCCAAAATTGCACTATTATAGGACTT
GTATTGTTATTTAAATTACTGGATTCTAAGGAATTTCTTATCTGACAGAGCATCAGAACC
AGAGCTTGGTCCCACAGGCCACGGACCAATGGCCTGCAGCCGTGACAACACTCCTGTCAT
ATTGGAGTCCAAAACTTGAATTCTGGGTTGAATTTTTTAAAAATCAGTACCACTTGATTT
CATATGGGAAATTGAAGCAGAAATATTGAGGCTTCTTGATCACAGAAAACTCAGAGAGAA
AGTAATGCTCAGACAGGAGCGGCAGCCCCAG
Restriction Sites Please inquire     
Tag Tag Free
ACCN NM_000245
ORF Size 4173 bp
Insert Size 5000
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.NA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000245.2, NP_000236.2
RefSeq Size 6641
RefSeq ORF 4173
Locus ID 4233
Cytogenetics 7q31.2
Protein Families Druggable Genome, Protein Kinase, Transmembrane
Protein Pathways Adherens junction, Axon guidance, Colorectal cancer, Cytokine-cytokine receptor interaction, Endocytosis, Epithelial cell signaling in Helicobacter pylori infection, Focal adhesion, Melanoma, Pathways in cancer, Renal cell carcinoma
Gene Summary This gene encodes a member of the receptor tyrosine kinase family of proteins and the product of the proto-oncogene MET. The encoded preproprotein is proteolytically processed to generate alpha and beta subunits that are linked via disulfide bonds to form the mature receptor. Further processing of the beta subunit results in the formation of the M10 peptide, which has been shown to reduce lung fibrosis. Binding of its ligand, hepatocyte growth factor, induces dimerization and activation of the receptor, which plays a role in cellular survival, embryogenesis, and cellular migration and invasion. Mutations in this gene are associated with papillary renal cell carcinoma, hepatocellular carcinoma, and various head and neck cancers. Amplification and overexpression of this gene are also associated with multiple human cancers. [provided by RefSeq, May 2016]
Transcript Variant: This variant (2) uses an alternate in-frame splice junction at the end of an exon compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a.

Citations (4)

Other Versions

Frequently bought together (2)
MET mouse monoclonal antibody, clone OTI1E6 (formerly 1E6)
    • 100 ul

USD 360.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones