TMPRSS4 (NM_001083947) Human Untagged Clone

SKU
SC316217
TMPRSS4 (untagged)-Human transmembrane protease, serine 4 (TMPRSS4), transcript variant 3
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol TMPRSS4
Synonyms CAP2; CAPH2; MT-SP2; TMPRSS3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC316217 representing NM_001083947.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTTACAGGATCCTGACAGTGATCAACCTCTGAACAGCCTCGATGTCAAACCCCTGCGCAAACCCCGT
ATCCCCATGGAGACCTTCAGAAAGGTGGGGATCCCCATCATCATAGCACTACTGAGCCTGGCGAGTATC
ATCATTGTGGTTGTCCTCATCAAGGTGATTCTGGATAAATACTACTTCCTCTGCGGGCAGCCTCTCCAC
TTCATCCCGAGGAAGCAGCTGTGTGACGGAGAGCTGGACTGTCCCTTGGGGGAGGACGAGGAGCACTGT
GTCAAGAGCTTCCCCGAAGGGCCTGCAGTGGCAGTCCGCCTCTCCAAGGACCGATCCACACTGCAGGTG
CTGGACTCGGCCACAGGGAACTGGTTCTCTGCCTGTTTCGACAACTTCACAGAAGCTCTCGCTGAGACA
GCCTGTAGGCAGATGGGCTACAGCAGAGCTGTGGAGATTGGCCCAGACCAGGATCTGGATGTTGTTGAA
ATCACAGAAAACAGCCAGGAGCTTCGCATGCGGAACTCAAGTGGGCCCTGTCTCTCAGGCTCCCTGGTC
TCCCTGCACTGTCTTGCCTGTGGGAAGAGCCTGAAGACCCCCCGTGTGGTGGGTGGGGAGGAGGCCTCT
GTGGATTCTTGGCCTTGGCAGGTCAGCATCCAGTACGACAAACAGCACGTCTGTGGAGGGAGCATCCTG
GACCCCCACTGGGTCCTCACGGCAGCCCACTGCTTCAGGAAACATACCGATGTGTTCAACTGGAAGGTG
CGGGCAGGCTCAGACAAACTGGGCAGCTTCCCATCCCTGGCTGTGGCCAAGATCATCATCATTGAATTC
AACCCCATGTACCCCAAAGACAATGACATCGCCCTCATGAAGCTGCAGTTCCCACTCACTTTCTCAGGC
ACAGTCAGGCCCATCTGTCTGCCCTTCTTTGATGAGGAGCTCACTCCAGCCACCCCACTCTGGATCATT
GGATGGGGCTTTACGAAGCAGAATGGAGGGAAGATGTCTGACATACTGCTGCAGGCGTCAGTCCAGGTC
ATTGACAGCACACGGTGCAATGCAGACGATGCGTACCAGGGGGAAGTCACCGAGAAGATGATGTGTGCA
GGCATCCCGGAAGGGGGTGTGGACACCTGCCAGGGTGACAGTGGTGGGCCCCTGATGTACCAATCTGAC
CAGTGGCATGTGGTGGGCATCGTTAGTTGGGGCTATGGCTGCGGGGGCCCGAGCACCCCAGGAGTATAC
ACCAAGGTCTCAGCCTATCTCAACTGGATCTACAATGTCTGGAAGGCTGAGCTGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001083947
Insert Size 1299 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001083947.1
RefSeq Size 3534 bp
RefSeq ORF 1299 bp
Locus ID 56649
UniProt ID Q9NRS4
Cytogenetics 11q23.3
Protein Families Druggable Genome, Protease, Transmembrane
MW 47.6 kDa
Summary This gene encodes a member of the serine protease family. Serine proteases are known to be involved in a variety of biological processes, whose malfunction often leads to human diseases and disorders. This gene was identified as a gene overexpressed in pancreatic carcinoma. The encoded protein is membrane bound with a N-terminal anchor sequence and a glycosylated extracellular region containing the serine protease domain. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) uses an alternate in-frame splice site in the central coding region, compared to variant 1, resulting in a shorter protein (isoform 3). The splice acceptor site used for the first intron of this variant is polymorphic in the human population (rs2276122), and it is not known if this variant can be expressed from individuals with the 'A' allele. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.
Write Your Own Review
You're reviewing:TMPRSS4 (NM_001083947) Human Untagged Clone
Your Rating
SKU Description Size Price
RC224725 TMPRSS4 (Myc-DDK-tagged)-Human transmembrane protease, serine 4 (TMPRSS4), transcript variant 3 10 ug
$289.00 MSRP $457.00 MSRP $457.00
RC224725L1 Lenti ORF clone of Human transmembrane protease, serine 4 (TMPRSS4), transcript variant 3, Myc-DDK-tagged 10 ug
$757.00
RC224725L2 Lenti ORF clone of Human transmembrane protease, serine 4 (TMPRSS4), transcript variant 3, mGFP tagged 10 ug
$757.00
RC224725L3 Lenti ORF clone of Human transmembrane protease, serine 4 (TMPRSS4), transcript variant 3, Myc-DDK-tagged 10 ug
$757.00
RC224725L4 Lenti ORF clone of Human transmembrane protease, serine 4 (TMPRSS4), transcript variant 3, mGFP tagged 10 ug
$757.00
RG224725 TMPRSS4 (tGFP-tagged) - Human transmembrane protease, serine 4 (TMPRSS4), transcript variant 3 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.