NAA60 (NM_001083600) Human Untagged Clone
SKU
SC316047
NAA60 (untagged)-Human N-acetyltransferase 15 (GCN5-related, putative) (NAT15), transcript variant 3
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | NAA60 |
Synonyms | HAT4; hNaa60; NAT15; NatF |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>SC316047 representing NM_001083600.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGACAGAGGTGGTGCCATCCAGCGCGCTCAGCGAGGTCAGCCTGCGCCTCCTCTGCCACGATGACATA GACACTGTGAAGCACCTGTGTGGCGACTGGTTCCCCATCGAGTACCCAGACTCATGGTATCGTGATATC ACATCCAACAAGAAGTTCTTTTCCCTTGCTGCAACCTACAGAGGTGCCATTGTGGGAATGATAGTAGCT GAAATTAAGAACAGGACCAAAATACATAAAGAGGATGGAGATATTCTAGCATCCAACTTCTCTGTTGAC ACACAAGTCGCGTACATCCTAAGTCTGGGCGTCGTGAAAGAGTTCAGGAAGCACGGCATAGGTTCCCTC TTACTTGAAAGTTTAAAGGATCACATATCAACCACCGCCCAGGACCACTGCAAAGCCATTTACCTGCAT GTCCTCACCACCAACAACACAGCAATAAACTTCTATGAAAACAGAGACTTCAAGCAGCACCACTATCTC CCCTATTACTACTCCATTCGAGGGGTCCTCAAAGATGGCTTCACCTATGTCCTCTACATCAACGGCGGC CACCCTCCCTGGACGATTTTGGACTACATCCAGCACCTGGGCTCTGCACTAGCCAGCCTGAGCCCCTGC TCCATTCCGCACAGAGTCTACCGCCAGGCCCACAGCCTGCTCTGCAGCTTCCTGCCATGGTCGGGCATC TCTTCCAAGAGTGGCATCGAGTACAGCCGGACCATGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001083600 |
Insert Size | 729 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001083600.2 |
RefSeq Size | 2649 bp |
RefSeq ORF | 729 bp |
Locus ID | 79903 |
UniProt ID | Q9H7X0 |
Cytogenetics | 16p13.3 |
MW | 27.5 kDa |
Summary | This gene encodes an enzyme that localizes to the Golgi apparatus, where it transfers an acetyl group to the N-terminus of free proteins. This enzyme acts on histones, and its activity is important for chromatin assembly and chromosome integrity. Alternative splicing and the use of alternative promoters results in multiple transcript variants. The upstream promoter is located in a differentially methylated region (DMR) and undergoes imprinting; transcript variants originating from this position are expressed from the maternal allele. [provided by RefSeq, Nov 2015] Transcript Variant: This variant (3) represents use of an alternate promoter and differs in the 5' UTR, compared to variant 1. Variants 1, 2, and 3 encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC224843 | NAA60 (Myc-DDK-tagged)-Human N-acetyltransferase 15 (GCN5-related, putative) (NAT15), transcript variant 3 | 10 ug |
$300.00
|
|
RC224843L3 | Lenti ORF clone of Human N-acetyltransferase 15 (GCN5-related, putative) (NAT15), transcript variant 3, Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC224843L4 | Lenti ORF clone of Human N-acetyltransferase 15 (GCN5-related, putative) (NAT15), transcript variant 3, mGFP tagged | 10 ug |
$600.00
|
|
RG224843 | NAA60 (tGFP-tagged) - Human N-acetyltransferase 15 (GCN5-related, putative) (NAT15), transcript variant 3 | 10 ug |
$489.00
MSRP
$500.00
MSRP
$500.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.