DNAJB2 (NM_006736) Human Untagged Clone

SKU
SC315992
DNAJB2 (untagged)-Human DnaJ (Hsp40) homolog, subfamily B, member 2 (DNAJB2), transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol DNAJB2
Synonyms CMT2T; DSMA5; HSJ-1; HSJ1; HSPF3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC315992 representing NM_006736.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCATCCTACTACGAGATCCTAGACGTGCCGCGAAGTGCGTCCGCTGATGACATCAAGAAGGCGTAT
CGGCGCAAGGCTCTCCAGTGGCACCCAGACAAAAACCCAGATAATAAAGAGTTTGCTGAGAAGAAATTT
AAGGAGGTGGCCGAGGCATATGAAGTGCTGTCTGACAAGCACAAGCGGGAGATTTACGACCGCTATGGC
CGGGAAGGGCTGACAGGGACAGGAACTGGCCCATCTCGGGCAGAAGCTGGCAGTGGTGGGCCTGGCTTC
ACCTTCACCTTCCGCAGCCCCGAGGAGGTCTTCCGGGAATTCTTTGGGAGTGGAGACCCTTTTGCAGAG
CTCTTTGATGACCTGGGCCCCTTCTCAGAGCTTCAGAACCGGGGTTCCCGACACTCAGGCCCCTTCTTT
ACCTTCTCTTCCTCCTTCCCTGGGCACTCCGATTTCTCCTCCTCATCTTTCTCCTTCAGTCCTGGGGCT
GGTGCTTTTCGCTCTGTTTCTACATCTACCACCTTTGTCCAAGGACGCCGCATCACCACACGCAGAATC
ATGGAGAACGGGCAGGAGCGGGTGGAAGTGGAGGAGGATGGGCAGCTGAAGTCAGTCACAATCAATGGT
GTCCCAGATGACCTGGCACTGGGCTTGGAGCTGAGCCGTCGCGAGCAGCAGCCGTCAGTCACTTCCAGG
TCTGGGGGCACTCAGGTCCAGCAGACCCCTGCCTCATGCCCCTTGGACAGCGACCTCTCTGAGGATGAG
GACCTGCAGCTGGCCATGGCCTACAGCCTGTCAGAGATGGAGGCAGCTGGGAAGAAACCCGCAGGTGGG
CGGGAGGCACAGCACCGACGGCAGGGGCGGCCCAAGGCCCAGCACCAAGATCCAGGCTTGGGGGGGACC
CAGGAGGGTGCGAGGGGTGAAGCAACCAAACGCAGTCCATCCCCAGAGGAGAAGGCCTCTCGCTGCCTC
ATCCTCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_006736
Insert Size 975 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_006736.5
RefSeq Size 3129 bp
RefSeq ORF 975 bp
Locus ID 3300
UniProt ID P25686
Cytogenetics 2q35
Domains DnaJ, UIM
MW 35.6 kDa
Summary This gene is almost exclusively expressed in the brain, mainly in the neuronal layers. It encodes a protein that shows sequence similarity to bacterial DnaJ protein and the yeast homologs. In bacteria, this protein is implicated in protein folding and protein complex dissociation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2011]
Transcript Variant: This variant (2) is alternatively spliced at the 3' end compared to variant 1. This results in a longer isoform (b) with a distinct C-terminus compared to isoform a.
Write Your Own Review
You're reviewing:DNAJB2 (NM_006736) Human Untagged Clone
Your Rating
SKU Description Size Price
RC201081 DNAJB2 (Myc-DDK-tagged)-Human DnaJ (Hsp40) homolog, subfamily B, member 2 (DNAJB2), transcript variant 2 10 ug
$300.00
RC201081L3 Lenti ORF clone of Human DnaJ (Hsp40) homolog, subfamily B, member 2 (DNAJB2), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC201081L4 Lenti ORF clone of Human DnaJ (Hsp40) homolog, subfamily B, member 2 (DNAJB2), transcript variant 2, mGFP tagged 10 ug
$600.00
RG201081 DNAJB2 (tGFP-tagged) - Human DnaJ (Hsp40) homolog, subfamily B, member 2 (DNAJB2), transcript variant 2 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.