LILRB2 (NM_001080978) Human Untagged Clone

SKU
SC315962
LILRB2 (untagged)-Human leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2 (LILRB2), transcript variant 2
$835.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol LILRB2
Synonyms CD85D; ILT-4; ILT4; LIR-2; LIR2; MIR-10; MIR10
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001080978 edited
ATGACCCCCATCGTCACAGTCCTGATCTGTCTCGGGCTGAGTCTGGGCCCCAGGACCCAC
GTGCAGACAGGGACCATCCCCAAGCCCACCCTGTGGGCTGAGCCAGACTCTGTGATCACC
CAGGGGAGTCCCGTCACCCTCAGTTGTCAGGGGAGCCTTGAAGCCCAGGAGTACCGTCTA
TATAGGGAGAAAAAATCAGCATCTTGGATTACACGGATACGACCAGAGCTTGTGAAGAAC
GGCCAGTTCCACATCCCATCCATCACCTGGGAACACACAGGGCGATATGGCTGTCAGTAT
TACAGCCGCGCTCGGTGGTCTGAGCTCAGTGACCCCCTGGTGCTGGTGATGACAGGAGCC
TACCCAAAACCCACCCTCTCAGCCCAGCCCAGCCCTGTGGTGACCTCAGGAGGAAGGGTG
ACCCTCCAGTGTGAGTCACAGGTGGCATTTGGCGGCTTCATTCTGTGTAAGGAAGGAGAA
GATGAACACCCACAATGCCTGAACTCCCAGCCCCATGCCCGTGGGTCGTCCCGCGCCATC
TTCTCCGTGGGCCCCGTGAGCCCGAATCGCAGGTGGTCGCACAGGTGCTATGGTTATGAC
TTGAACTCTCCCTATGTGTGGTCTTCACCCAGTGATCTCCTGGAGCTCCTGGTCCCAGGT
GTTTCTAAGAAGCCATCACTCTCAGTGCAGCCGGGTCCTGTCGTGGCCCCTGGGGAAAGC
CTGACCCTCCAGTGTGTCTCTGATGTCGGCTATGACAGATTTGTTCTGTACAAGGAGGGG
GAACGTGACCTTCGCCAGCTCCCTGGCCGGCAGCCCCAGGCTGGGCTCTCCCAGGCCAAC
TTCACCCTGGGCCCTGTGAGCCGCTCCTACGGGGGCCAGTACAGATGCTACGGTGCATAC
AACCTCTCCTCCGAGTGGTCGGCCCCCAGCGACCCCCTGGACATCCTGATCACAGGACAG
ATCCATGGCACACCCTTCATCTCAGTGCAGCCAGGCCCCACAGTGGCCTCAGGAGAGAAC
GTGACCCTGCTGTGTCAGTCATGGCGGCAGTTCCACACTTTCCTTCTGACCAAGGCGGGA
GCAGCTGATGCCCCACTCCGTCTAAGATCAATACACGAATATCCTAAGTACCAGGCTGAA
TTCCCCATGAGTCCTGTGACCTCAGCCCACGCGGGGACCTACAGGTGCTACGGCTCACTC
AACTCCGACCCCTACCTGCTGTCTCACCCCAGTGAGCCCCTGGAGCTCGTGGTCTCAGGA
CCCTCCATGGGTTCCAGCCCCCCACCCACCGGTCCCATCTCCACACCTGCAGGCCCTGAG
GACCAGCCCCTCACCCCCACTGGGTCGGATCCCCAAAGTGGTCTGGGAAGGCACCTGGGG
GTTGTGATCGGCATCTTGGTGGCCGTCGTCCTACTGCTCCTCCTCCTCCTCCTCCTCTTC
CTCATCCTCCGACATCGACGTCAGGGCAAACACTGGACATCAACCCAGAGAAAGGCTGAT
TTCCAACATCCTGCAGGGGCTGTGGGGCCAGAGCCCACAGACAGAGGCCTGCAGTGGAGG
TCCAGCCCAGCTGCCGACGCCCAGGAAGAAAACCTCTATGCTGCCGTGAAGGACACACAG
CCTGAAGATGGGGTGGAGATGGACACTCGGGCTGCTGCATCTGAAGCCCCCCAGGATGTG
ACCTACGCCCAGCTGCACAGCTTGACCCTCAGACGGAAGGCAACTGAGCCTCCTCCATCC
CAGGAAGGGGAACCTCCAGCTGAGCCCAGCATCTACGCCACCCTGGCCATCCACTAG
Restriction Sites Please inquire
ACCN NM_001080978
Insert Size 1800 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001080978.1, NP_001074447.1
RefSeq Size 2910 bp
RefSeq ORF 1794 bp
Locus ID 10288
Cytogenetics 19q13.42
Protein Families Transmembrane
Summary This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). The receptor is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the central coding region, compared to variant 1. The encoded isoform (2) is shorter, compared to isoform 1. Both variants 2 and 3 encode the same isoform.
Write Your Own Review
You're reviewing:LILRB2 (NM_001080978) Human Untagged Clone
Your Rating
SKU Description Size Price
RC217935 LILRB2 (Myc-DDK-tagged)-Human leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2 (LILRB2), transcript variant 2 10 ug
$835.00
RC217935L1 Lenti ORF clone of Human leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2 (LILRB2), transcript variant 2, Myc-DDK-tagged 10 ug
$1,135.00
RC217935L2 Lenti ORF clone of Human leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2 (LILRB2), transcript variant 2, mGFP tagged 10 ug
$1,135.00
RC217935L3 Lenti ORF clone of Human leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2 (LILRB2), transcript variant 2, Myc-DDK-tagged 10 ug
$1,135.00
RC217935L4 Lenti ORF clone of Human leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2 (LILRB2), transcript variant 2, mGFP tagged 10 ug
$1,135.00
RG217935 LILRB2 (tGFP-tagged) - Human leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2 (LILRB2), transcript variant 2 10 ug
$1,035.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.