CT47A9 (NM_001080138) Human Untagged Clone

SKU
SC315728
CT47A9 (untagged)-Human cancer/testis antigen family 47, member A9 (CT47A9)
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CT47A9
Synonyms CT47.9
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC315728 representing NM_001080138.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCTGCCACAGGGGACCGACACCCGACCCAAGGGGACCAGGAGGCCCCGGTAAGCCAGGAGGGAGCA
CAGGCCGAGGCGGCCGGAGCTGGTAACCAGGAGGGCGGCGACTCCGGCCCCGACAGCAGCGACGTGGTG
CCTGCGGCCGAGGTGGTCGGAGTCGCAGGGCCCGTGGAAGGCCTCGGGGAGGAGGAGGGTGAGCAGGCG
GCAGGCCTGGCCGCAGTCCCCCGGGGCGGGAGCGCCGAGGAGGACTCAGATATCGGGCCCGCGACGGAG
GAAGAGGAGGAGGAAGAGGGGAACGAGGCGGCCAACTTCGACTTGGCGGTGGTCGCCCGTCGCTACCCG
GCGTCGGGCATTCACTTCGTGCTCCTGGACATGGTCCACTCCCTTCTCCACCGCCTCTCTCACAACGAC
CACATCCTCATAGAGAACCGTCAACTCAGCCGCCTGATGGTGGGGCCACACGCTGCTGCGCGCAACCTC
TGGGGCAACCTCCCCCCGCTGCTGCTGCCCCAGAGGCTGGGTGCAGGGGCCGCAGCCCGGGCGGGCGAG
GGCCTGGGCCTGATCCAGGAGGCCGCATCGGTCCCAGAGCCTGCAGTGCCAGCTGACCTGGCCGAGATG
GCCAGGGAGCCCGCGGAGGAGGCCGCAGAGGAGAAGCTCTCAGAGGAGGCCACAGAGGAACCAGACGCA
GAGGAACCGGCCACAGAAGAACCGACCGCACAGGAGGCCACGGCCCCAGAGGAAGTCACTAAATCTCAG
CCCGAAAAGTGGGATGAAGAGGCCCAAGATGCTGCAGGCGAGGAAGAGAAAGAACAAGAAAAAGAGAAG
GATGCGGAAAACAAGGTGAAGAACTCCAAAGGGACCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001080138
Insert Size 867 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001080138.1
RefSeq Size 1294 bp
RefSeq ORF 867 bp
Locus ID 728042
UniProt ID Q5JQC4
Cytogenetics Xq24
MW 30.1 kDa
Summary This locus represents a member of the cancer/testis gene family 47. This family, also known as CT47, is comprised of 13 nearly identical loci clustered at Xq24. [provided by RefSeq, Sep 2010]
Write Your Own Review
You're reviewing:CT47A9 (NM_001080138) Human Untagged Clone
Your Rating
SKU Description Size Price
RC214587 CT47A9 (Myc-DDK-tagged)-Human cancer/testis antigen family 47, member A9 (CT47A9) 10 ug
$300.00
RC214587L3 Lenti ORF clone of Human cancer/testis antigen family 47, member A9 (CT47A9), Myc-DDK-tagged 10 ug
$600.00
RC214587L4 Lenti ORF clone of Human cancer/testis antigen family 47, member A9 (CT47A9), mGFP tagged 10 ug
$600.00
RG214587 CT47A9 (tGFP-tagged) - Human cancer/testis antigen family 47, member A9 (CT47A9) 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.