SNTN (NM_001080537) Human Untagged Clone

SKU
SC315675
SNTN (untagged)-Human sentan, cilia apical structure protein (SNTN)
$165.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SNTN
Synonyms S100A1L; S100AL; sentan
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC315675 representing NM_001080537.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGTGGCTGTATGCACAGTACCCAGGACAAATCTCTCCACTTGGAAGGAGATCCCAATCCTTCTGCA
GCCCCAACATCCACCTGCGCACCTAGGAAAATGCCCAAAAGGATTTCAATATCCAAACAACTGGCTTCA
GTGAAAGCTCTGAGGAAGTGCTCAGATCTGGAAAAAGCTATTGCCACCACTGCTCTGATTTTCAGAAAT
TCTTCTGACTCTGATGGTAAACTTGAAAAAGCTATTGCCAAAGATCTGCTGCAAACCCAATTTAGGAAT
TTCGCAGAGGGACAAGAAACCAAGCCAAAATACAGAGAGATCCTTTCTGAACTTGATGAGCACACAGAA
AATAAGCTAGATTTTGAAGACTTCATGATCTTGCTCTTAAGCATCACTGTCATGTCAGATCTGCTACAA
AATATACGGAATGTAAAAATTATGAAATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001080537
Insert Size 444 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001080537.1
RefSeq Size 1586 bp
RefSeq ORF 444 bp
Locus ID 132203
UniProt ID A6NMZ2
Cytogenetics 3p14.2
MW 16.5 kDa
Summary May be a component of the linker structure that bridges the ciliary membrane and peripheral singlet microtubules.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
Write Your Own Review
You're reviewing:SNTN (NM_001080537) Human Untagged Clone
Your Rating
SKU Description Size Price
RC214753 SNTN (Myc-DDK-tagged)-Human sentan, cilia apical structure protein (SNTN) 10 ug
$150.00
RC214753L3 Lenti ORF clone of Human sentan, cilia apical structure protein (SNTN), Myc-DDK-tagged 10 ug
$450.00
RC214753L4 Lenti ORF clone of Human sentan, cilia apical structure protein (SNTN), mGFP tagged 10 ug
$450.00
RG214753 SNTN (tGFP-tagged) - Human sentan, cilia apical structure protein (SNTN) 10 ug
$350.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.