Kallikrein 5 (KLK5) (NM_001077491) Human Untagged Clone

SKU
SC315511
KLK5 (untagged)-Human kallikrein-related peptidase 5 (KLK5), transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Kallikrein 5
Synonyms KLK-L2; KLKL2; SCTE
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC315511 representing NM_001077491.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTACAGCAAGACCCCCCTGGATGTGGGTGCTCTGTGCTCTGATCACAGCCTTGCTTCTGGGGGTC
ACAGAGCATGTTCTCGCCAACAATGATGTTTCCTGTGACCACCCCTCTAACACCGTGCCCTCTGGGAGC
AACCAGGACCTGGGAGCTGGGGCCGGGGAAGACGCCCGGTCGGATGACAGCAGCAGCCGCATCATCAAT
GGATCCGACTGCGATATGCACACCCAGCCGTGGCAGGCCGCGCTGTTGCTAAGGCCCAACCAGCTCTAC
TGCGGGGCGGTGTTGGTGCATCCACAGTGGCTGCTCACGGCCGCCCACTGCAGGAAGAAAGTTTTCAGA
GTCCGTCTCGGCCACTACTCCCTGTCACCAGTTTATGAATCTGGGCAGCAGATGTTCCAGGGGGTCAAA
TCCATCCCCCACCCTGGCTACTCCCACCCTGGCCACTCTAACGACCTCATGCTCATCAAACTGAACAGA
AGAATTCGTCCCACTAAAGATGTCAGACCCATCAACGTCTCCTCTCATTGTCCCTCTGCTGGGACAAAG
TGCTTGGTGTCTGGCTGGGGGACAACCAAGAGCCCCCAAGTGCACTTCCCTAAGGTCCTCCAGTGCTTG
AATATCAGCGTGCTAAGTCAGAAAAGGTGCGAGGATGCTTACCCGAGACAGATAGATGACACCATGTTC
TGCGCCGGTGACAAAGCAGGTAGAGACTCCTGCCAGGGTGATTCTGGGGGGCCTGTGGTCTGCAATGGC
TCCCTGCAGGGACTCGTGTCCTGGGGAGATTACCCTTGTGCCCGGCCCAACAGACCGGGTGTCTACACG
AACCTCTGCAAGTTCACCAAGTGGATCCAGGAAACCATCCAGGCCAACTCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001077491
Insert Size 882 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001077491.1
RefSeq Size 1435 bp
RefSeq ORF 882 bp
Locus ID 25818
UniProt ID Q9Y337
Cytogenetics 19q13.41
Protein Families Druggable Genome, Protease, Secreted Protein, Transmembrane
MW 32 kDa
Summary Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Its expression is up-regulated by estrogens and progestins. The encoded protein is secreted and may be involved in desquamation in the epidermis. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. All variants encode the same protein.
Write Your Own Review
You're reviewing:Kallikrein 5 (KLK5) (NM_001077491) Human Untagged Clone
Your Rating
SKU Description Size Price
RC217479 KLK5 (Myc-DDK-tagged)-Human kallikrein-related peptidase 5 (KLK5), transcript variant 2 10 ug
$300.00
RC217479L1 Lenti ORF clone of Human kallikrein-related peptidase 5 (KLK5), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC217479L2 Lenti ORF clone of Human kallikrein-related peptidase 5 (KLK5), transcript variant 2, mGFP tagged 10 ug
$600.00
RC217479L3 Lenti ORF clone of Human kallikrein-related peptidase 5 (KLK5), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC217479L4 Lenti ORF clone of Human kallikrein-related peptidase 5 (KLK5), transcript variant 2, mGFP tagged 10 ug
$600.00
RG217479 KLK5 (tGFP-tagged) - Human kallikrein-related peptidase 5 (KLK5), transcript variant 2 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.