ART5 (NM_001079536) Human Untagged Clone

SKU
SC315510
ART5 (untagged)-Human ADP-ribosyltransferase 5 (ART5), transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol ART5
Synonyms ARTC5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC315510 representing NM_001079536.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGCTGGCGGCTTTGATGATCGCCCTCGGCAGCCTCGGCCTCCACACCTGGCAGGCCCAGGCTGTT
CCCATCCTGCCCCTGGGCCTGGCTCCAGACACCTTTGACGATACCTATGTGGGTTGTGCAGAGGAGATG
GAGGAGAAGGCAGCCCCCCTGCTAAAGGAGGAAATGGCCCACCATGCCCTGCTGCGGGAATCCTGGGAG
GCAGCCCAGGAGACCTGGGAGGACAAGCGTCGAGGGCTTACCTTGCCCCCTGGCTTCAAAGCCCAGAAT
GGAATAGCCATTATGGTCTACACCAACTCATCGAACACCTTGTACTGGGAGTTGAATCAGGCCGTGCGG
ACGGGCGGAGGCTCCCGGGAGCTCTACATGAGGCACTTTCCCTTCAAGGCCCTGCATTTCTACCTGATC
CGGGCCCTGCAGCTGCTGCGAGGCAGTGGGGGCTGCAGCAGGGGACCTGGGGAGGTGGTGTTCCGAGGT
GTGGGCAGCCTTCGCTTTGAACCCAAGAGGCTGGGAGACTCTGTCCGCTTGGGCCAGTTTGCCTCCAGC
TCCCTGGATAAGGCAGTGGCCCACAGATTTGGTAATGCCACCCTCTTCTCTCTAACAACTTGCTTTGGG
GCCCCTATACAGGCCTTCTCTGTCTTTCCCAAGGAGCGCGAGGTGCTGATTCCCCCCCATGAAGTCTTT
TTGGTTACCAGATTCTCTCAGGATGGAGCCCAGAGCTTGGTGACTCTCTGGAGCTATAATCAGACCTGT
AGCCATTTTAACTGCGCCTATCTGGGTGGGGAGAAGAGGCGGGGCTGTGTGTCTGCGCCAGGAGCCCTG
GGAACGGGTGACCTTCATATGACGAAGAGGCACCTCCAGCAGCCTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001079536
Insert Size 876 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001079536.1
RefSeq Size 1249 bp
RefSeq ORF 876 bp
Locus ID 116969
UniProt ID Q96L15
Cytogenetics 11p15.4
Protein Families Secreted Protein
MW 32.1 kDa
Summary The protein encoded by this gene belongs to the ARG-specific ADP-ribosyltransferase family. Proteins in this family regulate the function of target proteins by attaching ADP-ribose to specific amino acid residues in their target proteins. The mouse homolog lacks a glycosylphosphatidylinositol-anchor signal sequence and is predicted to be a secretory enzyme. Several transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (2) contains a different 5' UTR compared to transcript variant 1. Variants 1 and 2 both encode the same isoform (a).
Write Your Own Review
You're reviewing:ART5 (NM_001079536) Human Untagged Clone
Your Rating
SKU Description Size Price
RC221774 ART5 (Myc-DDK-tagged)-Human ADP-ribosyltransferase 5 (ART5), transcript variant 2 10 ug
$300.00
RC221774L3 Lenti ORF clone of Human ADP-ribosyltransferase 5 (ART5), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC221774L4 Lenti ORF clone of Human ADP-ribosyltransferase 5 (ART5), transcript variant 2, mGFP tagged 10 ug
$600.00
RG221774 ART5 (tGFP-tagged) - Human ADP-ribosyltransferase 5 (ART5), transcript variant 2 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.