KIAA1191 (NM_001079684) Human Untagged Clone

SKU
SC315509
KIAA1191 (untagged)-Human KIAA1191 (KIAA1191), transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol KIAA1191
Synonyms p33MONOX; p60MONOX
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001079684, the custom clone sequence may differ by one or more nucleotides
ATGTCCCTGCCCATCGGGATATACCGCCGGGCAGTCAGCTATGATGATACCCTCGAGGAC
CCTGCGCCCATGACTCCTCCTCCATCGGACATGGGCAGCGTCCCTTGGAAGCCAGTGATT
CCAGAGCGCAAGTATCAGCACCTCGCCAAGGTGGAGGAAGGAGAGGCCAGTCTACCCTCC
CCTGCCATGACCCTGTCATCAGCCATTGACAGTGTGGACAAGGTCCCAGTGGTGAAGGCT
AAAGCTACCCATGTCATCATGAATTCTCTGATCACAAAACAGACCCAGGAAAGCATTCAG
CATTTTGAGCGACAGGCAGGGCTGAGAGATGCTGGCTACACACCCCACAAGGGCCTCACC
ACCGAGGAGACCAAGTACCTTCGAGTGGCCGAAGCACTCCACAAACTAAAGTTACAGAGT
GGAGAGGTAACAAAAGAAGAGAGGCAGCCTGCATCAGCCCAGTCCACCCCAAGCACCACT
CCGCACTCTTCACCTAAGCAGAGGCCCAGGGGCTGGTTCACTTCTGGTTCTTCCACAGCC
TTACCTGGCCCAAATCCTAGCACCATGGACTCTGGAAGTGGGGATAAGGACAGAAACTTG
TCAGATAAGTGGAGCCTCTTTGGACCGAGATCCCTTCAGAAGTACGATTCTGGAAGTTTT
GCCACCCAGGCCTACCGAGGAGCCCAGAAGCCCTCTCCATTGGAACTGATACGTGCCCAG
GCCAACCGAATGGCTGAAGATCCAGCAGCCTTGAAGCCCCCCAAGATGGACATCCCAGTG
ATGGAAGGAAAGAAACAGCCACCACGGGCCCATAACCTCAAACCCCGTGACCTGAATGTG
CTCACACCCACTGGCTTC
Restriction Sites Please inquire
ACCN NM_001079684
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001079684.1, NP_001073152.1
RefSeq Size 2765 bp
RefSeq ORF 861 bp
Locus ID 57179
UniProt ID Q96A73
Cytogenetics 5q35.2
Summary Potential NADPH-dependent oxidoreductase. May be involved in the regulation of neuronal survival, differentiation and axonal outgrowth.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks part of the 5' coding region and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (b) has a shorter N-terminus, compared to isoform a. Both variants 2 and 5 encode the same isoform.
Write Your Own Review
You're reviewing:KIAA1191 (NM_001079684) Human Untagged Clone
Your Rating
SKU Description Size Price
RC224240 KIAA1191 (Myc-DDK-tagged)-Human KIAA1191 (KIAA1191), transcript variant 2 10 ug
$300.00
RC224240L3 Lenti ORF clone of Human KIAA1191 (KIAA1191), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC224240L4 Lenti ORF clone of Human KIAA1191 (KIAA1191), transcript variant 2, mGFP tagged 10 ug
$600.00
RG224240 KIAA1191 (tGFP-tagged) - Human KIAA1191 (KIAA1191), transcript variant 2 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.