SLC10A3 (NM_019848) Human Untagged Clone

SKU
SC313651
SLC10A3 (untagged)-Human solute carrier family 10 (sodium/bile acid cotransporter family), member 3 (SLC10A3), transcript variant 1
$457.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SLC10A3
Synonyms DXS253E; P3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_019848, the custom clone sequence may differ by one or more nucleotides


ATGGTGTTAATGCAGGACAAGGGCAGCTCTCAGCAGTGGCCTGGTCTGGGGGGCGAGGGTGGTGGCACAG
GTCCCTTAAGCATGCTCAGAGCTGCCCTGCTGCTCATCAGCCTGCCATGGGGGGCCCAAGGGACAGCCAG
CACCAGCCTCAGCACTGCTGGGGGTCACACCGTGCCACCGACTGGGGGCCGCTACTTGAGCATTGGAGAT
GGCTCTGTGATGGAGTTTGAGTTTCCTGAGGACAGTGAGGGCATCATCGTGATCTCCAGCCAGTACCCAG
GCCAGGCCAACAGGACGGCGCCTGGCCCCATGCTCAGGGTCACCTCCCTGGACACAGAGGTGCTGACCAT
CAAGAACGTGAGTGCTATAACCTGGGGAGGCGGGGGTGGCTTTGTGGTGAGCATCCACTCAGGCCTGGCT
GGGCTGGCCCCACTCCACATCCAGCTCGTGGACGCCCATGAGGCCCCGCCCACACTGATTGAGGAGCGGA
GAGACTTCTGCATCAAGGTCTCACCTGCTGAAGACACGCCTGCCACCCTCAGCGCCGACCTGGCCCACTT
CTCGGAAAACCCAATCCTCTACCTGCTCCTGCCTCTTATCTTTGTCAACAAGTGTTCGTTTGGGTGCAAA
GTGGAACTCGAGGTTCTGAAGGGGCTCATGCAGAGCCCCCAGCCCATGCTGCTGGGCCTCCTGGGCCAGT
TTCTGGTCATGCCCTTGTACGCTTTCCTCATGGCCAAGGTCTTCATGCTGCCCAAGGCCCTGGCTCTGGG
CCTCATCATCACCTGCTCGTCGCCTGGCGGCGGGGGGAGCTACCTCTTCAGCCTCCTTCTTGGAGGGGAC
GTCACCCTGGCCATCTCCATGACTTTCCTCTCTACGGTGGCTGCCACTGGCTTCTTGCCTCTGTCTTCGG
CCATCTACAGCCGCCTGCTCAGCATCCATGAGACGCTCCACGTGCCCATCTCCAAGATCCTGGGGACCCT
GCTGTTCATTGCCATCCCCATAGCCGTGGGCGTGCTGATCAAGTCCAAGCTCCCCAAGTTCTCCCAGCTG
CTGCTGCAGGTCGTCAAGCCCTTCAGCTTTGTGCTCCTCCTGGGCGGCCTCTTCCTGGCCTATCGCATGG
GGGTCTTCATCCTGGCAGGCATCCGGCTACCCATCGTACTGGTGGGTATCACGGTGCCCCTGGTTGGCCT
GTTGGTGGGCTACTGCCTAGCCACGTGTCTGAAGCTGCCAGTGGCCCAGCGGCGGACGGTCAGCATTGAG
GTAGGGGTGCAGAACAGCCTGCTGGCCTTGGCCATGCTGCAGCTATCCCTCCGCCGCCTTCAAGCTGACT
ATGCCTCCCAGGCCCCCTTCATTGTGGCGCTGAGCGGCACCTCCGAGATGCTGGCCTTGGTCATTGGCCA
CTTCATCTACAGCAGCCTGTTCCCAGTTCCCTGA


Restriction Sites Please inquire
ACCN NM_019848
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_019848.2, NP_062822.1
RefSeq Size 2123 bp
RefSeq ORF 1434 bp
Locus ID 8273
UniProt ID P09131
Cytogenetics Xq28
Domains SBF
Protein Families Druggable Genome, Transmembrane
Summary This gene maps to a GC-rich region of the X chromosome and was identified by its proximity to a CpG island. It is thought to be a housekeeping gene. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Dec 2008]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). Variants 1 and 3 encode the same isoform.
Write Your Own Review
You're reviewing:SLC10A3 (NM_019848) Human Untagged Clone
Your Rating
SKU Description Size Price
RC214087 SLC10A3 (Myc-DDK-tagged)-Human solute carrier family 10 (sodium/bile acid cotransporter family), member 3 (SLC10A3), transcript variant 1 10 ug
$457.00
RC214087L3 Lenti ORF clone of Human solute carrier family 10 (sodium/bile acid cotransporter family), member 3 (SLC10A3), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC214087L4 Lenti ORF clone of Human solute carrier family 10 (sodium/bile acid cotransporter family), member 3 (SLC10A3), transcript variant 1, mGFP tagged 10 ug
$757.00
RG214087 SLC10A3 (tGFP-tagged) - Human solute carrier family 10 (sodium/bile acid cotransporter family), member 3 (SLC10A3), transcript variant 1 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.