WDR1 (NM_005112) Human Untagged Clone

SKU
SC313603
WDR1 (untagged)-Human WD repeat domain 1 (WDR1), transcript variant 2
$686.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol WDR1
Synonyms AIP1; HEL-S-52; NORI-1; PFITS
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_005112, the custom clone sequence may differ by one or more nucleotides


ATGCCGTACGAGATCAAGAAGGTGTTCGCCAGCCTCCCGCAGGTGGAGAGGGGCGTCTCCAAGATCATCG
GCGGCGACCCTAAGGGCAACAATTTTCTGTACACCAATGGAAAGTGCGTCATCCTAAGGAACATCGACGA
CCACAGCCGCTTTGTCAACTGTGTGCGATTCTCTCCTGATGGGAACAGATTTGCCACAGCCAGTGCTGAC
GGCCAGATATACATCTATGACGGGAAGACTGGGGAGAAGGTGTGCGCGCTGGGCGGAAGCAAGGCCCACG
ACGGTGGGATTTACGCAATTAGTTGGAGTCCCGACAGCACCCATTTGCTTTCTGCTTCTGGGGACAAAAC
TTCCAAGATTTGGGACGTCAGCGTGAACTCCGTGGTCAGCACATTTCCCATGGGCTCCACGGTTCTGGAC
CAGCAGCTGGGCTGCCTATGGCAGAAGGACCACCTGCTCAGTGTCTCCCTGTCCGGGTACATCAACTATC
TGGACAGAAACAACCCCAGCAAGCCCCTGCACGTCATCAAGGGTCACAGTAAATCGATCCAGTGTCTGAC
GGTGCATAAAAACGGCGGCAAGTCCTACATTTACTCTGGGAGCCACGACGGACACATTAATTACTGGGAT
TCAGAGACGGGGGAGAACGACTCCTTCGCTGGGAAAGGCCACACGAACCAGGTGTCCAGGATGACCGTGG
ATGAGTCGGGGCAGCTCATCAGCTGCAGCATGGACGACACCGTGCGGTACACCAGCCTCATGCTGCGGGA
CTACAGCGGACAAGGAGTTGTGAAACTGGACGTTCAGCCAAAGTGCGTAGCCGTCGGCCCCGGGGGATAC
GCCGTGGTCGTGTGCATTGGACAGATTGTCCTGCTGAAGGATCAGAGGAAGTGCTTCAGCATCGACAACC
CCGGCTACGAGCCCGAAGTTGTGGCAGTGCACCCCGGCGGGGACACGGTGGCAATTGGGGGTGTGGACGG
CAACGTCCGCCTGTATTCCATCCTGGGCACCACGCTGAAGGATGAGGGCAAGCTCCTAGAGGCCAAGGGC
CCCGTGACCGACGTGGCCTACTCCCACGACGGCGCCTTCCTCGCGGTGTGCGACGCCAGCAAGGTGGTCA
CAGTGTTCAGCGTTGCTGACGGCTACTCGGAGAACAATGTTTTTTATGGACACCATGCAAAAATCGTCTG
CCTGGCCTGGTCCCCAGACAATGAACACTTTGCCTCCGGTGGCATGGACATGATGGTGTATGTTTGGACC
CTGAGTGACCCGGAAACCAGAGTCAAGATCCAAGATGCACACCGGCTGCACCATGTCAGCAGCCTGGCCT
GGCTGGACGAGCACACGCTGGTCACGACCTCCCATGATGCCTCTGTCAAGGAGTGGACAATCACCTACTG
A


Restriction Sites Please inquire
ACCN NM_005112
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_005112.4, NP_005103.2
RefSeq Size 2740 bp
RefSeq ORF 1401 bp
Locus ID 9948
UniProt ID O75083
Cytogenetics 4p16.1
Domains WD40
Summary This gene encodes a protein containing 9 WD repeats. WD repeats are approximately 30- to 40-amino acid domains containing several conserved residues, mostly including a trp-asp at the C-terminal end. WD domains are involved in protein-protein interactions. The encoded protein may help induce the disassembly of actin filaments. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks an alternate in-frame segment compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1.
Write Your Own Review
You're reviewing:WDR1 (NM_005112) Human Untagged Clone
Your Rating
SKU Description Size Price
RC217868 WDR1 (Myc-DDK-tagged)-Human WD repeat domain 1 (WDR1), transcript variant 2 10 ug
$686.00
RC217868L3 Lenti-ORF clone of WDR1 (Myc-DDK-tagged)-Human WD repeat domain 1 (WDR1), transcript variant 2 10 ug
$986.00
RC217868L4 Lenti-ORF clone of WDR1 (mGFP-tagged)-Human WD repeat domain 1 (WDR1), transcript variant 2 10 ug
$986.00
RG217868 WDR1 (tGFP-tagged) - Human WD repeat domain 1 (WDR1), transcript variant 2 10 ug
$886.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.