P2X5 (P2RX5) (NM_175080) Human Untagged Clone

SKU
SC313295
P2RX5 (untagged)-Human purinergic receptor P2X, ligand-gated ion channel, 5 (P2RX5), transcript variant 2
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol P2X5
Synonyms LRH-1; P2X5; P2X5R
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC313295 representing NM_175080.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGGCAGGCGGGCTGCAAGGGGCTCTGCCTGTCGCTGTTCGACTACAAGACCGAGAAGTATGTCATC
GCCAAGAACAAGAAGGTGGGCCTGCTGTACCGGCTGCTGCAGGCCTCCATCCTGGCGTACCTGGTCGTA
TGGGTGTTCCTGATAAAGAAGGGTTACCAAGACGTCGACACCTCCCTGCAGAGTGCTGTCATCACCAAA
GTCAAGGGCGTGGCCTTCACCAACACCTCGGATCTTGGGCAGCGGATCTGGGATGTCGCCGACTACGTC
ATTCCAGCCCAGAATGAAGGCATTCCTGATGGCGCGTGCTCCAAGGACAGCGACTGCCACGCTGGGGAA
GCGGTTACAGCTGGAAACGGAGTGAAGACCGGCCGCTGCCTGCGGAGAGAGAACTTGGCCAGGGGCACC
TGTGAGATCTTTGCCTGGTGCCCGTTGGAGACAAGCTCCAGGCCGGAGGAGCCATTCCTGAAGGAGGCC
GAAGACTTCACCATTTTCATAAAGAACCACATCCGTTTCCCCAAATTCAACTTCTCCAACAATGTGATG
GACGTCAAGGACAGATCTTTCCTGAAATCATGCCACTTTGGCCCCAAGAACCACTACTGCCCCATCTTC
CGACTGGGCTCCGTGATCCGCTGGGCCGGGAGCGACTTCCAGGATATAGCCCTGGAGGGTGGCGTGATA
GGAATTAATATTGAATGGAACTGTGATCTTGATAAAGCTGCCTCTGAGTGCCACCCTCACTATTCTTTT
AGCCGTCTGGACAATAAACTTTCAAAGTCTGTCTCCTCCGGGTACAACTTCAGATTTGCCAGATATTAC
CGAGACGCAGCCGGGGTGGAGTTCCGCACCCTGATGAAAGCCTACGGGATCCGCTTTGACGTGATGGTG
AACGGCAAGGGTGCTTTCTTCTGCGACCTGGTACTCATCTACCTCATCAAAAAGAGAGAGTTTTACCGT
GACAAGAAGTACGAGGAAGTGAGGGGCCTAGAAGACAGTTCCCAGGAGGCCGAGGACGAGGCATCGGGG
CTGGGGCTATCTGAGCAGCTCACATCTGGGCCAGGGCTGCTGGGGATGCCGGAGCAGCAGGAGCTGCAG
GAGCCACCCGAGGCGAAGCGTGGAAGCAGCAGTCAGAAGGGGAACGGATCTGTGTGCCCACAGCTCCTG
GAGCCCCACAGGAGCACGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_175080
Insert Size 1194 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_175080.2
RefSeq Size 2266 bp
RefSeq ORF 1194 bp
Locus ID 5026
UniProt ID Q93086
Cytogenetics 17p13.2
Protein Families Druggable Genome, Ion Channels: ATP Receptors, Transmembrane
Protein Pathways Calcium signaling pathway, Neuroactive ligand-receptor interaction
MW 44.4 kDa
Summary The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream gene, TAX1BP3 (Tax1 binding protein 3). [provided by RefSeq, Mar 2011]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 5' coding region, and uses an alternate in-frame splice site in the central coding region, compared to variant 1, resulting in an isoform (B) that is shorter than isoform A.
Write Your Own Review
You're reviewing:P2X5 (P2RX5) (NM_175080) Human Untagged Clone
Your Rating
SKU Description Size Price
RC213813 P2RX5 (Myc-DDK-tagged)-Human purinergic receptor P2X, ligand-gated ion channel, 5 (P2RX5), transcript variant 2 10 ug
$457.00
RC213813L3 Lenti ORF clone of Human purinergic receptor P2X, ligand-gated ion channel, 5 (P2RX5), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC213813L4 Lenti ORF clone of Human purinergic receptor P2X, ligand-gated ion channel, 5 (P2RX5), transcript variant 2, mGFP tagged 10 ug
$757.00
RG213813 P2RX5 (tGFP-tagged) - Human purinergic receptor P2X, ligand-gated ion channel, 5 (P2RX5), transcript variant 2 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.