TIA1 (NM_022173) Human Untagged Clone
SKU
SC313245
TIA1 (untagged)-Human TIA1 cytotoxic granule-associated RNA binding protein (TIA1), transcript variant 2
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | TIA1 |
Synonyms | ALS26; TIA-1; WDM |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>SC313245 representing NM_022173.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGAGGACGAGATGCCCAAGACTCTATACGTCGGTAACCTTTCCAGAGATGTGACAGAAGCTCTAATT CTGCAACTCTTTAGCCAGATTGGACCTTGTAAAAACTGCAAAATGATTATGGATACAGCTGGAAATGAT CCCTATTGTTTTGTGGAGTTTCATGAGCATCGTCATGCAGCTGCAGCATTAGCTGCTATGAATGGACGG AAGATAATGGGTAAGGAAGTCAAAGTGAATTGGGCAACAACCCCTAGCAGTCAAAAGAAAGATACAAGC AGTAGTACCGTTGTCAGCACACAGCGTTCACAAGATCATTTCCATGTCTTTGTTGGTGATCTCAGCCCA GAAATTACAACTGAAGATATAAAAGCTGCTTTTGCACCATTTGGAAGAATATCAGATGCCCGAGTGGTA AAAGACATGGCAACAGGAAAGTCTAAGGGATATGGCTTTGTCTCCTTTTTCAACAAATGGGATGCTGAA AACGCCATTCAACAGATGGGTGGCCAGTGGCTTGGTGGAAGACAAATCAGAACTAACTGGGCAACCCGA AAGCCTCCCGCTCCAAAGAGTACATATGAGTCAAATACCAAACAGCTATCATATGATGAGGTTGTAAAT CAGTCTAGTCCAAGCAACTGTACTGTATACTGTGGAGGTGTTACTTCTGGGCTAACAGAACAACTAATG CGTCAGACTTTTTCACCATTTGGACAAATAATGGAAATTCGAGTCTTTCCAGATAAAGGATATTCATTT GTTCGGTTCAATTCCCATGAAAGTGCAGCACATGCAATTGTTTCTGTTAATGGTACTACCATTGAAGGT CATGTTGTGAAATGCTATTGGGGCAAAGAAACTCTTGATATGATAAATCCCGTGCAACAGCAGAATCAA ATTGGATATCCCCAACCTTATGGCCAGTGGGGCCAGTGGTATGGAAATGCACAACAAATTGGCCAGTAT ATGCCTAATGGTTGGCAAGTTCCTGCATATGGAATGTATGGCCAGGCATGGAACCAGCAAGGATTTAAT CAGACACAGTCTTCTGCACCATGGATGGGACCAAATTATGGAGTGCAACCGCCTCAAGGGCAAAATGGC AGCATGTTGCCCAATCAGCCTTCTGGGTATCGAGTGGCAGGGTATGAAACCCAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_022173 |
Insert Size | 1161 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_022173.2 |
RefSeq Size | 4653 bp |
RefSeq ORF | 1161 bp |
Locus ID | 7072 |
UniProt ID | P31483 |
Cytogenetics | 2p13.3 |
Domains | RRM, RRM_1 |
Protein Families | Druggable Genome |
MW | 43 kDa |
Summary | The product encoded by this gene is a member of a RNA-binding protein family and possesses nucleolytic activity against cytotoxic lymphocyte (CTL) target cells. It has been suggested that this protein may be involved in the induction of apoptosis as it preferentially recognizes poly(A) homopolymers and induces DNA fragmentation in CTL targets. The major granule-associated species is a 15-kDa protein that is thought to be derived from the carboxyl terminus of the 40-kDa product by proteolytic processing. Alternative splicing resulting in different isoforms has been found for this gene. [provided by RefSeq, May 2017] Transcript Variant: This variant (2) includes exon 5, which is missing in transcript variant 1, resulting in the longer isoform (2). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC219386 | TIA1 (Myc-DDK-tagged)-Human TIA1 cytotoxic granule-associated RNA binding protein (TIA1), transcript variant 2 | 10 ug |
$686.00
|
|
RC219386L1 | Lenti ORF clone of Human TIA1 cytotoxic granule-associated RNA binding protein (TIA1), transcript variant 2, Myc-DDK-tagged | 10 ug |
$986.00
|
|
RC219386L2 | Lenti ORF clone of Human TIA1 cytotoxic granule-associated RNA binding protein (TIA1), transcript variant 2, mGFP tagged | 10 ug |
$986.00
|
|
RC219386L3 | Lenti ORF clone of Human TIA1 cytotoxic granule-associated RNA binding protein (TIA1), transcript variant 2, Myc-DDK-tagged | 10 ug |
$986.00
|
|
RC219386L4 | Lenti ORF clone of Human TIA1 cytotoxic granule-associated RNA binding protein (TIA1), transcript variant 2, mGFP tagged | 10 ug |
$986.00
|
|
RG219386 | TIA1 (tGFP-tagged) - Human TIA1 cytotoxic granule-associated RNA binding protein (TIA1), transcript variant 2 | 10 ug |
$886.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.