FANCF (NM_022725) Human Untagged Clone

SKU
SC313192
FANCF (untagged)-Human Fanconi anemia, complementation group F (FANCF)
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol FANCF
Synonyms FAF
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC313192 representing NM_022725.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTC
AGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGG
CGCTTTGGTCGGCATGGCCCCATTCGCACGGCTCTGGAGCGGCGGCTGCACAACCAGTGGAGGCAAGAG
GGCGGCTTTGGGCGGGGTCCAGTTCCGGGATTAGCGAACTTCCAGGCCCTCGGTCACTGTGACGTCCTG
CTCTCTCTGCGCCTGCTGGAGAACCGGGCCCTCGGGGATGCAGCTCGTTACCACCTGGTGCAGCAACTC
TTTCCCGGCCCGGGCGTCCGGGACGCCGATGAGGAGACACTCCAAGAGAGCCTGGCCCGCCTTGCCCGC
CGGCGGTCTGCGGTGCACATGCTGCGCTTCAATGGCTATAGAGAGAACCCAAATCTCCAGGAGGACTCT
CTGATGAAGACCCAGGCGGAGCTGCTGCTGGAGCGTCTGCAGGAGGTGGGGAAGGCCGAAGCGGAGCGT
CCCGCCAGGTTTCTCAGCAGCCTGTGGGAGCGCTTGCCTCAGAACAACTTCCTGAAGGTGATAGCGGTG
GCGCTGTTGCAGCCGCCTTTGTCTCGTCGGCCCCAAGAAGAGTTGGAACCCGGCATCCACAAATCACCT
GGAGAGGGGAGCCAAGTGCTAGTCCACTGGCTTCTGGGGAATTCGGAAGTCTTTGCTGCCTTTTGTCGC
GCCCTCCCAGCCGGGCTTTTGACTTTAGTGACTAGCCGCCACCCAGCGCTGTCTCCTGTCTATCTGGGT
CTGCTAACAGACTGGGGTCAACGTTTGCACTATGACCTTCAGAAAGGCATTTGGGTTGGAACTGAGTCC
CAAGATGTGCCCTGGGAGGAGTTGCACAATAGGTTTCAAAGCCTCTGTCAGGCCCCTCCACCTCTGAAA
GATAAAGTTCTAACTGCCCTGGAGACCTGTAAAGCGCAGGATGGAGATTTTGAAGTACCTGGTCTTAGC
ATCTGGACAGACCTCTTATTAGCTCTTCGTAGTGGTGCATTTAGGAAAAGACAAGTTTTGGGTCTCAGC
GCAGGCCTCAGTTCTGTATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_022725
Insert Size 1125 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_022725.3
RefSeq Size 3309 bp
RefSeq ORF 1125 bp
Locus ID 2188
UniProt ID Q9NPI8
Cytogenetics 11p14.3
Protein Families Druggable Genome
MW 42.3 kDa
Summary The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group F. [provided by RefSeq, Jul 2008]
Write Your Own Review
You're reviewing:FANCF (NM_022725) Human Untagged Clone
Your Rating
SKU Description Size Price
RC208920 FANCF (Myc-DDK-tagged)-Human Fanconi anemia, complementation group F (FANCF) 10 ug
$457.00
RC208920L1 Lenti ORF clone of Human Fanconi anemia, complementation group F (FANCF), Myc-DDK-tagged 10 ug
$757.00
RC208920L2 Lenti ORF clone of Human Fanconi anemia, complementation group F (FANCF), mGFP tagged 10 ug
$757.00
RC208920L3 Lenti ORF clone of Human Fanconi anemia, complementation group F (FANCF), Myc-DDK-tagged 10 ug
$757.00
RC208920L4 Lenti ORF clone of Human Fanconi anemia, complementation group F (FANCF), mGFP tagged 10 ug
$757.00
RG208920 FANCF (tGFP-tagged) - Human Fanconi anemia, complementation group F (FANCF) 10 ug
$489.00 MSRP $657.00 MSRP $657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.