NDRG4 (NM_022910) Human Untagged Clone

SKU
SC313177
NDRG4 (untagged)-Human NDRG family member 4 (NDRG4), transcript variant 3
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol NDRG4
Synonyms BDM1; SMAP-8; SMAP8
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC313177 representing NM_022910.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCGGGCTGCAGGAGCTGCGATTCCCTGAGGAGAAGCCGCTGCTCCGGGGCCAGGACGCCACCGAG
CTGGAGAGCTCCGATGCCTTCCTCTTGGCTGCAGACACAGACTGGAAGGAACATGACATCGAGACACCC
TACGGCCTTCTGCATGTAGTGATCCGGGGCTCCCCCAAGGGGAACCGCCCAGCCATCCTCACCTACCAT
GATGTGGGCCTCAACCACAAACTATGCTTCAACACCTTCTTCAACTTCGAGGACATGCAGGAGATCACC
AAGCACTTTGTGGTGTGTCACGTGGATGCCCCTGGACAACAGGTGGGGGCGTCGCAGTTTCCTCAGGGG
TACCAGTTCCCCTCCATGGAGCAGCTGGCTGCCATGCTCCCCAGCGTGGTGCAGCATTTCGGGTTCAAG
TATGTGATTGGCATCGGAGTGGGCGCCGGAGCCTATGTGCTGGCCAAGTTTGCACTCATCTTCCCCGAC
CTGGTGGAGGGGCTGGTGCTGGTGAACATCGACCCCAATGGCAAAGGCTGGATAGACTGGGCTGCCACC
AAGCTCTCCGGCCTAACTAGCACTTTACCCGACACGGTGCTCTCCCACCTCTTCAGCCAGGAGGAGCTG
GTGAACAACACAGAGTTGGTGCAGAGCTACCGGCAGCAGATTGGGAACGTGGTGAACCAGGCCAACCTG
CAGCTCTTCTGGAACATGTACAACAGCCGCAGAGACCTGGACATTAACCGGCCTGGAACGGTGCCCAAT
GCCAAGACGCTCCGCTGCCCCGTGATGCTGGTGGTTGGGGATAATGCACCCGCTGAGGACGGGGTGGTG
GAGTGCAACTCCAAACTGGACCCGACCACTACGACCTTCCTGAAGATGGCAGACTCTGGAGGGCTGCCC
CAGGTCACACAGCCAGGGAAGCTGACTGAAGCCTTCAAATACTTCCTGCAAGGCATGGGCTACATGCCC
TCAGCCAGCATGACCCGCCTGGCACGCTCCCGCACTGCATCCCTCACCAGTGCCAGCTCGGTGGATGGC
AGCCGCCCACAGGCCTGCACCCACTCAGAGAGCAGCGAGGGGCTGGGCCAGGTCAACCACACCATGGAG
GTGTCCTGTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_022910
Insert Size 1116 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_022910.3
RefSeq Size 3453 bp
RefSeq ORF 1116 bp
Locus ID 65009
UniProt ID Q9ULP0
Cytogenetics 16q21
Domains Ndr
MW 40.6 kDa
Summary This gene is a member of the N-myc downregulated gene family which belongs to the alpha/beta hydrolase superfamily. The protein encoded by this gene is a cytoplasmic protein that is required for cell cycle progression and survival in primary astrocytes and may be involved in the regulation of mitogenic signalling in vascular smooth muscles cells. Alternative splicing results in multiple transcripts encoding different isoforms.[provided by RefSeq, Jun 2011]
Transcript Variant: This variant (3) differs in the 5' UTR which results in the use of an in-frame downstream translation initiation codon, compared to variant 2. The encoded protein (isoform 1; also known as NDRG4-H) has a shorter N-terminus, compared to isoform 2. Variants 1 and 3 encode the same isoform.
Write Your Own Review
You're reviewing:NDRG4 (NM_022910) Human Untagged Clone
Your Rating
SKU Description Size Price
RC221301 NDRG4 (Myc-DDK-tagged)-Human NDRG family member 4 (NDRG4), transcript variant 3 10 ug
$457.00
RC221301L3 Lenti ORF clone of Human NDRG family member 4 (NDRG4), transcript variant 3, Myc-DDK-tagged 10 ug
$757.00
RC221301L4 Lenti ORF clone of Human NDRG family member 4 (NDRG4), transcript variant 3, mGFP tagged 10 ug
$757.00
RG221301 NDRG4 (tGFP-tagged) - Human NDRG family member 4 (NDRG4), transcript variant 3 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.