FLJ14213 (PRR5L) (NM_024841) Human Untagged Clone

SKU
SC313161
PRR5L (untagged)-Human proline rich 5 like (PRR5L), transcript variant 2
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol FLJ14213
Synonyms PROTOR2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC313161 representing NM_024841.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACCCGCGGCTTCGCTCCCATTCTGCCCGTCGAGTTCCACAAGATGGGCTCCTTCCGCAGGCCTAGA
CCGCGCTTCATGAGCTCCCCCGTGCTCAGCGACCTTCCCCGATTCCAAGCAGCTCGGCAGGCTCTGCAG
CTGAGCTCCAGCTCAGCCTGGAACAGCGTTCAGACTGCTGTGATCAACGTTTTCAAAGGGGGTGGCTTG
CAAAGCAACGAGCTCTATGCCCTGAACGAAAACATCAGGCGGCTGTTGAAGAGTGAACTTGGATCATTC
ATTACAGACTATTTTCAGAACCAGCTTCTTGCAAAAGGACTGTTCTTTGTGGAGGAGAAGATCAAGCTG
TGTGAAGGTGAAAATCGCATTGAGGTTCTGGCTGAAGTCTGGGACCACTTCTTCACTGAGACTCTCCCT
ACCCTGCAGGCAATATTTTATCCAGTTCAGGGCCAGGAGCTGACTATCCGCCAGATCTCCCTGCTGGGC
TTCCGAGACCTAGTCTTGCTGAAGGTGAAGCTGGGTGACCTGCTGCTGCTGGCCCAGTCCAAGCTGCCC
TCGTCCATTGTCCAGATGTTGCTCATCCTGCAGAGTGTTCACGAGCCCACAGGCCCAAGTGAGAGTTAT
TTGCAACTGGAGGAGCTGGTGAAGCAAGTGGTTTCTCCTTTCCTCGGCATCAGCGGGGACCGTAGCTTC
TCAGGCCCCACGTACACGCTGGCCAGGCGGCACTCCAGGGTCCGGCCCAAGGTGACTGTCCTGAACTAT
GCCTCCCCGATAACCGCAGTCAGCCGGCCACTGAATGAGATGGTCTTGACCCCACTGACAGAGCAGGAG
GGGGAAGCCTACCTGGAGAAGTGTGGCAGCGTGCGGCGGCACACGGTGGCCAATGCCCACTCGGACATC
CAGCTGCTGGCCATGGCCACCATGATGCACTCGGGCCTGGGGGAGGAGGCCAGCAGTGAGAACAAGTGC
CTGCTCCTGCCACCCAGCTTCCCCCCGCCCCACCGGCAGTGCTCCAGTGAGCCCAACATCACTGACAAC
CCTGACGGACTGGAGGAGGGGGCCAGGGGCAGCCAGGAGGGCTCGGAGCTGAACTGTGCTTCCCTCAGC
TGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_024841
Insert Size 1107 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_024841.4
RefSeq Size 3965 bp
RefSeq ORF 1107 bp
Locus ID 79899
UniProt ID Q6MZQ0
Cytogenetics 11p13-p12
MW 40.8 kDa
Summary Associates with the mTORC2 complex that regulates cellular processes including survival and organization of the cytoskeleton (PubMed:17461779). Regulates the activity of the mTORC2 complex in a substrate-specific manner preventing for instance the specific phosphorylation of PKCs and thereby controlling cell migration (PubMed:22609986). Plays a role in the stimulation of ZFP36-mediated mRNA decay of several ZFP36-associated mRNAs, such as TNF-alpha and GM-CSF, in response to stress (PubMed:21964062). Required for ZFP36 localization to cytoplasmic stress granule (SG) and P-body (PB) in response to stress (PubMed:21964062).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:FLJ14213 (PRR5L) (NM_024841) Human Untagged Clone
Your Rating
SKU Description Size Price
RC223241 PRR5L (Myc-DDK-tagged)-Human proline rich 5 like (PRR5L), transcript variant 2 10 ug
$457.00
RC223241L1 Lenti ORF clone of Human proline rich 5 like (PRR5L), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC223241L2 Lenti ORF clone of Human proline rich 5 like (PRR5L), transcript variant 2, mGFP tagged 10 ug
$757.00
RC223241L3 Lenti ORF clone of Human proline rich 5 like (PRR5L), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC223241L4 Lenti ORF clone of Human proline rich 5 like (PRR5L), transcript variant 2, mGFP tagged 10 ug
$757.00
RG223241 PRR5L (tGFP-tagged) - Human proline rich 5 like (PRR5L), transcript variant 2 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.