Ataxin 3 (ATXN3) (NM_004993) Human Untagged Clone

SKU
SC313129
ATXN3 (untagged)-Human ataxin 3 (ATXN3), transcript variant reference
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Ataxin 3
Synonyms AT3; ATX3; JOS; MJD; MJD1; SCA3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC313129 representing NM_004993.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGTCCATCTTCCACGAGAAACAAGAAGGCTCACTTTGTGCTCAACATTGCCTGAATAACTTATTG
CAAGGAGAATATTTTAGCCCTGTGGAATTATCCTCAATTGCACATCAGCTGGATGAGGAGGAGAGGATG
AGAATGGCAGAAGGAGGAGTTACTAGTGAAGATTATCGCACGTTTTTACAGCAGCCTTCTGGAAATATG
GATGACAGTGGTTTTTTCTCTATTCAGGTTATAAGCAATGCCTTGAAAGTTTGGGGTTTAGAACTAATC
CTGTTCAACAGTCCAGAGTATCAGAGGCTCAGGATCGATCCTATAAATGAAAGATCATTTATATGCAAT
TATAAGGAACACTGGTTTACAGTTAGAAAATTAGGAAAACAGTGGTTTAACTTGAATTCTCTCTTGACG
GGTCCAGAATTAATATCAGATACATATCTTGCACTTTTCTTGGCTCAATTACAACAGGAAGGTTATTCT
ATATTTGTCGTTAAGGGTGATCTGCCAGATTGCGAAGCTGACCAACTCCTGCAGATGATTAGGGTCCAA
CAGATGCATCGACCAAAACTTATTGGAGAAGAATTAGCACAACTAAAAGAGCAAAGAGTCCATAAAACA
GACCTGGAACGAGTGTTAGAAGCAAATGATGGCTCAGGAATGTTAGACGAAGATGAGGAGGATTTGCAG
AGGGCTCTGGCACTAAGTCGCCAAGAAATTGACATGGAAGATGAGGAAGCAGATCTCCGCAGGGCTATT
CAGCTAAGTATGCAAGGTAGTTCCAGAAACATATCTCAAGATATGACACAGACATCAGGTACAAATCTT
ACTTCAGAAGAGCTTCGGAAGAGACGAGAAGCCTACTTTGAAAAACAGCAGCAAAAGCAGCAACAGCAG
CAGCAGCAGCAGCAGCAGGGGGACCTATCAGGACAGAGTTCACATCCATGTGAAAGGCCAGCCACCAGT
TCAGGAGCACTTGGGAGTGATCTAGGTGATGCTATGAGTGAAGAAGACATGCTTCAGGCAGCTGTGACC
ATGTCTTTAGAAACTGTCAGAAATGATTTGAAAACAGAAGGAAAAAAATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_004993
Insert Size 1086 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_004993.5
RefSeq Size 6923 bp
RefSeq ORF 1086 bp
Locus ID 4287
UniProt ID P54252
Cytogenetics 14q32.12
Domains Josephin, UIM
Protein Families Druggable Genome, Transcription Factors
MW 41.3 kDa
Summary Machado-Joseph disease, also known as spinocerebellar ataxia-3, is an autosomal dominant neurologic disorder. The protein encoded by this gene contains (CAG)n repeats in the coding region, and the expansion of these repeats from the normal 12-44 to 52-86 is one cause of Machado-Joseph disease. There is a negative correlation between the age of onset and CAG repeat numbers. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2016]
Transcript Variant: This variant (reference, also known as variant 1) encodes the longest isoform (reference isoform, also known as isoform 1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.
Write Your Own Review
You're reviewing:Ataxin 3 (ATXN3) (NM_004993) Human Untagged Clone
Your Rating
SKU Description Size Price
RC218923 ATXN3 (Myc-DDK-tagged)-Human ataxin 3 (ATXN3), transcript variant reference 10 ug
$457.00
RC218923L1 Lenti ORF clone of Human ataxin 3 (ATXN3), transcript variant reference, Myc-DDK-tagged 10 ug
$757.00
RC218923L2 Lenti ORF clone of Human ataxin 3 (ATXN3), transcript variant reference, mGFP tagged 10 ug
$757.00
RC218923L3 Lenti ORF clone of Human ataxin 3 (ATXN3), transcript variant reference, Myc-DDK-tagged 10 ug
$757.00
RC218923L4 Lenti ORF clone of Human ataxin 3 (ATXN3), transcript variant reference, mGFP tagged 10 ug
$757.00
RG218923 ATXN3 (tGFP-tagged) - Human ataxin 3 (ATXN3), transcript variant reference 10 ug
$489.00 MSRP $657.00 MSRP $657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.