Macrophage Scavenger Receptor I (MSR1) (NM_002445) Human Untagged Clone

SKU
SC313114
MSR1 (untagged)-Human macrophage scavenger receptor 1 (MSR1), transcript variant SR-AII
$457.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Macrophage Scavenger Receptor I
Synonyms CD204; phSR1; phSR2; SCARA1; SR-A; SR-AI; SR-AII; SR-AIII; SRA
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_002445 edited
ATAAATCAGTGCTGCTTTCTTTAGGACGAAAGAAGTATGGAGCAGTGGGATCACTTTCAC
AATCAACAGGAGGACACTGATAGCTGCTCCGAATCTGTGAAATTTGATGCTCGCTCAATG
ACAGCTTTGCTTCCTCCGAATCCTAAAAACAGCCCTTCCCTTCAAGAGAAACTGAAGTCC
TTCAAAGCTGCACTGATTGCCCTTTACCTCCTCGTGTTTGCAGTTCTCATCCCTCTCATT
GGAATAGTGGCAGCTCAACTCCTGAAGTGGGAAACGAAGAATTGCTCAGTTAGTTCAACT
AATGCAAATGATATAACTCAAAGTCTCACGGGAAAAGGAAATGACAGCGAAGAGGAAATG
AGATTTCAAGAAGTCTTTATGGAACACATGAGCAACATGGAGAAGAGAATCCAGCATATT
TTAGACATGGAAGCCAACCTCATGGACACAGAGCATTTCCAAAATTTCAGCATGACAACT
GATCAAAGATTTAATGACATTCTTCTGCAGCTAAGTACCTTGTTTTCCTCAGTCCAGGGA
CATGGGAATGCAATAGATGAAATCTCCAAGTCCTTAATAAGTTTGAATACCACATTGCTT
GATTTGCAGCTCAACATAGAAAATCTGAATGGCAAAATCCAAGAGAATACCTTCAAACAA
CAAGAGGAAATCAGTAAATTAGAGGAGCGTGTTTACAATGTATCAGCAGAAATTATGGCT
ATGAAAGAAGAACAAGTGCATTTGGAACAGGAAATAAAAGGAGAAGTGAAAGTACTGAAT
AACATCACTAATGATCTCAGACTGAAAGATTGGGAACATTCTCAGACCTTGAGAAATATC
ACTTTAATTCAAGGTCCTCCTGGACCCCCGGGTGAAAAAGGAGATCGAGGTCCCACTGGA
GAAAGTGGTCCACGAGGATTTCCAGGTCCAATAGGTCCTCCGGGTCTTAAAGGTGATCGG
GGAGCAATTGGCTTTCCTGGAAGTCGAGGACTCCCAGGATATGCCGGAAGGCCAGGAAAT
TCTGGACCAAAAGGCCAGAAAGGGGAAAAGGGGAGTGGAAACACATTAAGACCAGTACAA
CTCACTGATCATATTAGGGCAGGGCCCTCTTAA
Restriction Sites Please inquire
ACCN NM_002445
Insert Size 1100 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_002445.2.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002445.2, NP_002436.1
RefSeq Size 2823 bp
RefSeq ORF 1077 bp
Locus ID 4481
UniProt ID P21757
Cytogenetics 8p22
Domains Collagen, Macscav_rec
Protein Families Druggable Genome, Transmembrane
Summary This gene encodes the class A macrophage scavenger receptors, which include three different types (1, 2, 3) generated by alternative splicing of this gene. These receptors or isoforms are macrophage-specific trimeric integral membrane glycoproteins and have been implicated in many macrophage-associated physiological and pathological processes including atherosclerosis, Alzheimer's disease, and host defense. The isoforms type 1 and type 2 are functional receptors and are able to mediate the endocytosis of modified low density lipoproteins (LDLs). The isoform type 3 does not internalize modified LDL (acetyl-LDL) despite having the domain shown to mediate this function in the types 1 and 2 isoforms. It has an altered intracellular processing and is trapped within the endoplasmic reticulum, making it unable to perform endocytosis. The isoform type 3 can inhibit the function of isoforms type 1 and type 2 when co-expressed, indicating a dominant negative effect and suggesting a mechanism for regulation of scavenger receptor activity in macrophages. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (SR-AII), also known as phSR2, uses two alternative exons and also lacks two downstream exons compared to variant SR-AI. These differences causes an alternate 3' end in the coding region, and has a distinct 3' UTR. It encodes isoform type 2 that is shorter and has a different C-terminus than isoform type 1.
Write Your Own Review
You're reviewing:Macrophage Scavenger Receptor I (MSR1) (NM_002445) Human Untagged Clone
Your Rating
SKU Description Size Price
RC212931 MSR1 (Myc-DDK-tagged)-Human macrophage scavenger receptor 1 (MSR1), transcript variant SR-AII 10 ug
$457.00
RC212931L1 Lenti ORF clone of Human macrophage scavenger receptor 1 (MSR1), transcript variant SR-AII, Myc-DDK-tagged 10 ug
$757.00
RC212931L2 Lenti ORF clone of Human macrophage scavenger receptor 1 (MSR1), transcript variant SR-AII, mGFP tagged 10 ug
$757.00
RC212931L3 Lenti ORF clone of Human macrophage scavenger receptor 1 (MSR1), transcript variant SR-AII, Myc-DDK-tagged 10 ug
$757.00
RC212931L4 Lenti ORF clone of Human macrophage scavenger receptor 1 (MSR1), transcript variant SR-AII, mGFP tagged 10 ug
$757.00
RG212931 MSR1 (tGFP-tagged) - Human macrophage scavenger receptor 1 (MSR1), transcript variant SR-AII 10 ug
$489.00 MSRP $657.00 MSRP $657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.