RFC2 (NM_181471) Human Untagged Clone

SKU
SC313100
RFC2 (untagged)-Human replication factor C (activator 1) 2, 40kDa (RFC2), transcript variant 1
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol RFC2
Synonyms RFC40
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC313100 representing NM_181471.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGGTGGAGGCCGTCTGTGGTGGCGCGGGCGAGGTGGAGGCCCAGGACTCTGACCCTGCCCCTGCC
TTCAGCAAGGCCCCCGGCAGCGCCGGCCACTACGAACTGCCGTGGGTTGAAAAATATAGGCCAGTAAAG
CTGAATGAAATTGTCGGGAATGAAGACACCGTGAGCAGGCTAGAGGTCTTTGCAAGGGAAGGAAATGTG
CCCAACATCATCATTGCGGGCCCTCCAGGAACCGGCAAGACCACAAGCATTCTGTGCTTGGCCCGGGCC
CTGCTGGGCCCAGCACTCAAAGATGCCATGTTGGAACTCAATGCTTCAAATGACAGGGGCATTGACGTT
GTGAGGAATAAAATTAAAATGTTTGCTCAACAAAAAGTCACTCTTCCCAAAGGCCGACATAAGATCATC
ATTCTGGATGAAGCAGACAGCATGACCGACGGAGCCCAGCAAGCCTTGAGGAGAACCATGGAAATCTAC
TCTAAAACCACTCGCTTCGCCCTTGCTTGTAATGCTTCGGATAAGATCATCGAGCCCATTCAGTCCCGC
TGTGCAGTCCTCCGGTACACAAAGCTGACCGACGCCCAGATCCTCACCAGGCTGATGAATGTTATCGAG
AAGGAGAGGGTACCCTACACTGATGACGGCCTAGAAGCCATCATCTTCACGGCCCAGGGAGACATGAGG
CAGGCGCTGAACAACCTGCAGTCCACCTTCTCAGGATTTGGCTTCATTAACAGTGAGAACGTGTTCAAG
GTCTGTGACGAGCCCCACCCACTGCTGGTAAAGGAGATGATCCAGCACTGTGTGAATGCCAACATTGAC
GAAGCCTACAAGATTCTTGCTCACTTGTGGCATCTGGGCTACTCACCAGAAGATATCATTGGCAACATC
TTTCGAGTGTGTAAAACTTTCCAAATGGCAGAATACCTGAAACTGGAGTTTATCAAGGAAATTGGATAC
ACTCACATGAAAATAGCGGAAGGAGTGAACTCTCTTTTGCAGATGGCAGGCCTCCTGGCAAGGCTGTGT
CAGAAGACAATGGCCCCGGTGGCCAGTTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_181471
Insert Size 1065 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_181471.2
RefSeq Size 1759 bp
RefSeq ORF 1065 bp
Locus ID 5982
UniProt ID P35250
Cytogenetics 7q11.23
Protein Families Druggable Genome, Stem cell - Pluripotency
Protein Pathways DNA replication, Mismatch repair, Nucleotide excision repair
MW 39.2 kDa
Summary This gene encodes a member of the activator 1 small subunits family. The elongation of primed DNA templates by DNA polymerase delta and epsilon requires the action of the accessory proteins, proliferating cell nuclear antigen (PCNA) and replication factor C (RFC). Replication factor C, also called activator 1, is a protein complex consisting of five distinct subunits. This gene encodes the 40 kD subunit, which has been shown to be responsible for binding ATP and may help promote cell survival. Disruption of this gene is associated with Williams syndrome. Alternatively spliced transcript variants encoding distinct isoforms have been described. A pseudogene of this gene has been defined on chromosome 2. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (1) encodes the longest isoform (1).
Write Your Own Review
You're reviewing:RFC2 (NM_181471) Human Untagged Clone
Your Rating
SKU Description Size Price
RC220036 RFC2 (Myc-DDK-tagged)-Human replication factor C (activator 1) 2, 40kDa (RFC2), transcript variant 1 10 ug
$457.00
RC220036L3 Lenti ORF clone of Human replication factor C (activator 1) 2, 40kDa (RFC2), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC220036L4 Lenti ORF clone of Human replication factor C (activator 1) 2, 40kDa (RFC2), transcript variant 1, mGFP tagged 10 ug
$757.00
RG220036 RFC2 (tGFP-tagged) - Human replication factor C (activator 1) 2, 40kDa (RFC2), transcript variant 1 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.