LDLRAD3 (NM_174902) Human Untagged Clone
SKU
SC313048
LDLRAD3 (untagged)-Human low density lipoprotein receptor class A domain containing 3 (LDLRAD3)
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | LDLRAD3 |
Synonyms | LRAD3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>NCBI ORF sequence for NM_174902, the custom clone sequence may differ by one or more nucleotides
ATGTGGCTGCTGGGGCCGCTGTGCCTGCTGCTGAGCAGCGCCGCGGAGAGCCAGCTGCTCCCCGGGAACA ACTTCACCAATGAGTGCAACATACCAGGCAACTTCATGTGCAGCAATGGACGGTGCATCCCGGGCGCCTG GCAGTGTGACGGGCTGCCTGACTGCTTCGACAAGAGTGATGAGAAGGAGTGCCCCAAGGCTAAGTCGAAA TGTGGCCCAACCTTCTTCCCCTGTGCCAGCGGCATCCATTGCATCATTGGTCGCTTCCGGTGCAATGGGT TTGAGGACTGTCCCGATGGCAGCGATGAAGAGAACTGCACAGCAAACCCTCTGCTTTGCTCCACCGCCCG CTACCACTGCAAGAACGGCCTCTGTATTGACAAGAGCTTCATCTGCGATGGACAGAATAACTGTCAAGAC AACAGTGATGAGGAAAGCTGTGAAAGTTCTCAAGAACCCGGCAGTGGGCAGGTGTTTGTGACTTCAGAGA ACCAACTTGTGTATTACCCCAGCATCACCTATGCCATCATCGGCAGCTCCGTCATTTTTGTGCTGGTGGT GGCCCTGCTGGCACTGGTCTTGCACCACCAGCGGAAGCGGAACAACCTCATGACGCTGCCCGTGCACCGG CTGCAGCACCCTGTGCTGCTGTCCCGCCTGGTGGTCCTGGACCACCCCCACCACTGCAACGTCACCTACA ACGTCAATAATGGCATCCAGTATGTGGCCAGCCAGGCGGAGCAGAATGCGTCGGAAGTAGGCTCCCCACC CTCCTACTCCGAGGCCTTGCTGGACCAGAGGCCTGCGTGGTATGACCTTCCTCCACCGCCCTACTCTTCT GACACGGAATCTCTGAACCAAGCCGACCTGCCCCCCTACCGCTCCCGGTCCGGGAGTGCCAACAGTGCCA GCTCCCAGGCAGCCAGCAGCCTCCTGAGCGTGGAAGACACCAGCCACAGCCCGGGGCAGCCTGGCCCCCA GGAGGGCACTGCTGAGCCCAGGGACTCTGAGCCCAGCCAGGGCACTGAAGAAGTATAA |
Restriction Sites | Please inquire |
ACCN | NM_174902 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_174902.2, NP_777562.1 |
RefSeq Size | 2969 bp |
RefSeq ORF | 1038 bp |
Locus ID | 143458 |
UniProt ID | Q86YD5 |
Cytogenetics | 11p13 |
Protein Families | Druggable Genome, Transmembrane |
Summary | May influence APP processing, resulting in a decrease in sAPP-alpha production and increased amyloidogenic P3 peptide production.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC207286 | LDLRAD3 (Myc-DDK-tagged)-Human low density lipoprotein receptor class A domain containing 3 (LDLRAD3) | 10 ug |
$686.00
|
|
RC207286L3 | Lenti ORF clone of Human low density lipoprotein receptor class A domain containing 3 (LDLRAD3), Myc-DDK-tagged | 10 ug |
$986.00
|
|
RC207286L4 | Lenti ORF clone of Human low density lipoprotein receptor class A domain containing 3 (LDLRAD3), mGFP tagged | 10 ug |
$986.00
|
|
RG207286 | LDLRAD3 (tGFP-tagged) - Human low density lipoprotein receptor class A domain containing 3 (LDLRAD3) | 10 ug |
$886.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.