GM CSF Receptor alpha (CSF2RA) (NM_172247) Human Untagged Clone
SKU
SC313001
CSF2RA (untagged)-Human colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) (CSF2RA), transcript variant 4
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | GM CSF Receptor alpha |
Synonyms | alphaGMR; CD116; CDw116; CSF2R; CSF2RAX; CSF2RAY; CSF2RX; CSF2RY; GM-CSF-R-alpha; GMCSFR; GMCSFR-alpha; GMR; GMR-alpha; SMDP4 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>SC313001 representing NM_172247.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCTTCTCCTGGTGACAAGCCTTCTGCTCTGTGAGTTACCACACCCAGCATTCCTCCTGATCCCAGAG AAATCGGATCTGCGAACAGTGGCACCAGCCTCTAGTCTCAATGTGAGGTTTGACTCCAGGACGATGAAT TTAAGCTGGGACTGCCAAGAAAACACAACCTTCAGCAAGTGTTTCTTAACTGACAAGAAGAACAGAGTC GTGGAACCCAGGCTCAGTAACAACGAATGTTCGTGCACATTTCGTGAAATTTGTCTGCATGAAGGAGTC ACATTTGAGGTTCACGTGAATACTAGTCAAAGAGGATTTCAACAGAAACTGCTTTATCCAAATTCAGGA AGGGAGGGTACCGCTGCTCAGAATTTCTCCTGTTTCATCTACAATGCGGATTTAATGAACTGTACCTGG GCGAGGGGTCCGACGGCCCCCCGTGACGTCCAGTATTTTTTGTACATACGAAACTCAAAGAGAAGGAGG GAGATCCGGTGTCCTTATTACATACAAGACTCAGGAACCCATGTGGGATGTCACCTGGATAACCTGTCA GGATTAACGTCTCGCAATTACTTTCTGGTTAACGGAACCAGCCGAGAAATTGGCATCCAATTCTTTGAT TCACTTTTGGACACAAAGAAAATAGAACGATTCAACCCTCCCAGCAATGTCACCGTACGTTGCAACACG ACGCACTGCCTCGTACGGTGGAAACAGCCCAGGACCTATCAGAAGCTGTCGTACCTGGACTTTCAGTAC CAGCTGGACGTCCACAGAAAGAATACCCAGCCTGGCACGGAAAACCTACTGATTAATGTTTCTGGTGAT TTGGAAAATAGATACAACTTTCCAAGCTCTGAGCCCAGAGCAAAACACAGTGTGAAGATCAGAGCTGCA GACGTCCGCATCTTGAATTGGAGCTCCTGGAGTGAAGCCATTGAATTTGGTTCCTTAGGATACAGCGGC TGTTCCCGCCAGTTCCACAGATCAAAGACAAACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_172247 |
Insert Size | 1002 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_172247.2 |
RefSeq Size | 1590 bp |
RefSeq ORF | 1002 bp |
Locus ID | 1438 |
UniProt ID | P15509 |
Cytogenetics | X;Y |
Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
Protein Pathways | Cytokine-cytokine receptor interaction, Hematopoietic cell lineage, Jak-STAT signaling pathway, Pathways in cancer |
MW | 38.4 kDa |
Summary | The protein encoded by this gene is the alpha subunit of the heterodimeric receptor for colony stimulating factor 2, a cytokine which controls the production, differentiation, and function of granulocytes and macrophages. The encoded protein is a member of the cytokine family of receptors. This gene is found in the pseudoautosomal region (PAR) of the X and Y chromosomes. Multiple transcript variants encoding different isoforms have been found for this gene, with some of the isoforms being membrane-bound and others being soluble. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (4) lacks a coding exon in the 3' region, which causes a frameshift, compared to variant 1. The resulting isoform (c), which is likely soluble, is shorter and has a distinct C-terminus compared to isoform a. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC220607 | CSF2RA (Myc-DDK-tagged)-Human colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) (CSF2RA), transcript variant 4 | 10 ug |
$300.00
|
|
RC220607L3 | Lenti ORF clone of Human colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) (CSF2RA), transcript variant 4, Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC220607L4 | Lenti ORF clone of Human colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) (CSF2RA), transcript variant 4, mGFP tagged | 10 ug |
$600.00
|
|
RG220607 | CSF2RA (tGFP-tagged) - Human colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) (CSF2RA), transcript variant 4 | 10 ug |
$500.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.