GM CSF Receptor alpha (CSF2RA) (NM_172247) Human Untagged Clone

SKU
SC313001
CSF2RA (untagged)-Human colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) (CSF2RA), transcript variant 4
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol GM CSF Receptor alpha
Synonyms alphaGMR; CD116; CDw116; CSF2R; CSF2RAX; CSF2RAY; CSF2RX; CSF2RY; GM-CSF-R-alpha; GMCSFR; GMCSFR-alpha; GMR; GMR-alpha; SMDP4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC313001 representing NM_172247.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTTCTCCTGGTGACAAGCCTTCTGCTCTGTGAGTTACCACACCCAGCATTCCTCCTGATCCCAGAG
AAATCGGATCTGCGAACAGTGGCACCAGCCTCTAGTCTCAATGTGAGGTTTGACTCCAGGACGATGAAT
TTAAGCTGGGACTGCCAAGAAAACACAACCTTCAGCAAGTGTTTCTTAACTGACAAGAAGAACAGAGTC
GTGGAACCCAGGCTCAGTAACAACGAATGTTCGTGCACATTTCGTGAAATTTGTCTGCATGAAGGAGTC
ACATTTGAGGTTCACGTGAATACTAGTCAAAGAGGATTTCAACAGAAACTGCTTTATCCAAATTCAGGA
AGGGAGGGTACCGCTGCTCAGAATTTCTCCTGTTTCATCTACAATGCGGATTTAATGAACTGTACCTGG
GCGAGGGGTCCGACGGCCCCCCGTGACGTCCAGTATTTTTTGTACATACGAAACTCAAAGAGAAGGAGG
GAGATCCGGTGTCCTTATTACATACAAGACTCAGGAACCCATGTGGGATGTCACCTGGATAACCTGTCA
GGATTAACGTCTCGCAATTACTTTCTGGTTAACGGAACCAGCCGAGAAATTGGCATCCAATTCTTTGAT
TCACTTTTGGACACAAAGAAAATAGAACGATTCAACCCTCCCAGCAATGTCACCGTACGTTGCAACACG
ACGCACTGCCTCGTACGGTGGAAACAGCCCAGGACCTATCAGAAGCTGTCGTACCTGGACTTTCAGTAC
CAGCTGGACGTCCACAGAAAGAATACCCAGCCTGGCACGGAAAACCTACTGATTAATGTTTCTGGTGAT
TTGGAAAATAGATACAACTTTCCAAGCTCTGAGCCCAGAGCAAAACACAGTGTGAAGATCAGAGCTGCA
GACGTCCGCATCTTGAATTGGAGCTCCTGGAGTGAAGCCATTGAATTTGGTTCCTTAGGATACAGCGGC
TGTTCCCGCCAGTTCCACAGATCAAAGACAAACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_172247
Insert Size 1002 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_172247.2
RefSeq Size 1590 bp
RefSeq ORF 1002 bp
Locus ID 1438
UniProt ID P15509
Cytogenetics X;Y
Protein Families Druggable Genome, Secreted Protein, Transmembrane
Protein Pathways Cytokine-cytokine receptor interaction, Hematopoietic cell lineage, Jak-STAT signaling pathway, Pathways in cancer
MW 38.4 kDa
Summary The protein encoded by this gene is the alpha subunit of the heterodimeric receptor for colony stimulating factor 2, a cytokine which controls the production, differentiation, and function of granulocytes and macrophages. The encoded protein is a member of the cytokine family of receptors. This gene is found in the pseudoautosomal region (PAR) of the X and Y chromosomes. Multiple transcript variants encoding different isoforms have been found for this gene, with some of the isoforms being membrane-bound and others being soluble. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (4) lacks a coding exon in the 3' region, which causes a frameshift, compared to variant 1. The resulting isoform (c), which is likely soluble, is shorter and has a distinct C-terminus compared to isoform a.
Write Your Own Review
You're reviewing:GM CSF Receptor alpha (CSF2RA) (NM_172247) Human Untagged Clone
Your Rating
SKU Description Size Price
RC220607 CSF2RA (Myc-DDK-tagged)-Human colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) (CSF2RA), transcript variant 4 10 ug
$300.00
RC220607L3 Lenti ORF clone of Human colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) (CSF2RA), transcript variant 4, Myc-DDK-tagged 10 ug
$600.00
RC220607L4 Lenti ORF clone of Human colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) (CSF2RA), transcript variant 4, mGFP tagged 10 ug
$600.00
RG220607 CSF2RA (tGFP-tagged) - Human colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) (CSF2RA), transcript variant 4 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.