SULT1C4 (NM_006588) Human Untagged Clone

SKU
SC312868
SULT1C4 (untagged)-Human sulfotransferase family, cytosolic, 1C, member 4 (SULT1C4)
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SULT1C4
Synonyms SULT1C; SULT1C2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC312868 representing NM_006588.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCTTACACGACATGGAGGATTTTACATTTGATGGAACAAAGCGCTTAAGTGTCAACTACGTGAAG
GGAATTCTTCAACCGACAGACACCTGTGACATCTGGGATAAGATCTGGAACTTCCAAGCCAAGCCTGAT
GACCTGCTTATTTCTACCTATCCTAAAGCAGGAACAACATGGACTCAGGAGATAGTGGAATTAATACAA
AATGAAGGTGATGTGGAGAAAAGTAAACGGGCACCGACTCATCAACGATTTCCTTTCCTCGAAATGAAA
ATCCCATCCTTAGGATCTGGTTTGGAACAAGCTCATGCAATGCCCTCACCACGGATCCTGAAAACACAT
CTTCCCTTTCACTTGCTGCCACCATCCTTGCTAGAGAAAAACTGTAAGATAATCTATGTAGCAAGAAAT
CCCAAGGACAACATGGTGTCCTATTACCATTTCCAAAGAATGAATAAAGCTCTTCCTGCTCCAGGAACA
TGGGAAGAGTATTTTGAGACTTTTCTGGCTGGGAAAGTGTGCTGGGGCTCCTGGCATGAACATGTGAAA
GGATGGTGGGAAGCCAAAGACAAACACCGTATTCTCTATCTCTTCTATGAGGACATGAAGAAGAACCCA
AAGCATGAAATTCAGAAGCTGGCAGAATTTATTGGGAAGAAATTAGATGACAAAGTTCTAGATAAAATT
GTCCATTACACTTCGTTTGATGTCATGAAACAGAATCCAATGGCAAACTATTCATCGATTCCTGCTGAA
ATCATGGACCACTCCATTTCTCCATTCATGAGAAAAGGGGCAGTGGGAGACTGGAAGAAACACTTCACC
GTGGCTCAGAATGAGAGATTTGATGAAGATTACAAGAAGAAAATGACTGATACCAGACTAACTTTCCAC
TTCCAGTTCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_006588
Insert Size 909 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_006588.3
RefSeq Size 2874 bp
RefSeq ORF 909 bp
Locus ID 27233
UniProt ID O75897
Cytogenetics 2q12.3
Domains Sulfotransfer
MW 35.5 kDa
Summary Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene encodes a protein that belongs to the SULT1 subfamily, responsible for transferring a sulfo moiety from PAPS to phenol-containing compounds. [provided by RefSeq, Jul 2008]
Write Your Own Review
You're reviewing:SULT1C4 (NM_006588) Human Untagged Clone
Your Rating
SKU Description Size Price
RC213146 SULT1C4 (Myc-DDK-tagged)-Human sulfotransferase family, cytosolic, 1C, member 4 (SULT1C4) 10 ug
$300.00
RC213146L3 Lenti ORF clone of Human sulfotransferase family, cytosolic, 1C, member 4 (SULT1C4), Myc-DDK-tagged 10 ug
$600.00
RC213146L4 Lenti ORF clone of Human sulfotransferase family, cytosolic, 1C, member 4 (SULT1C4), mGFP tagged 10 ug
$600.00
RG213146 SULT1C4 (tGFP-tagged) - Human sulfotransferase family, cytosolic, 1C, member 4 (SULT1C4) 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.