ATP1B2 (NM_001678) Human Untagged Clone

SKU
SC312822
ATP1B2 (untagged)-Human ATPase, Na+/K+ transporting, beta 2 polypeptide (ATP1B2)
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol ATP1B2
Synonyms AMOG
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC312822 representing NM_001678.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGTCATCCAGAAAGAGAAGAAGAGCTGCGGGCAGGTGGTTGAGGAGTGGAAGGAGTTCGTGTGGAAC
CCGAGGACGCACCAGTTTATGGGCCGCACCGGGACCAGCTGGGCCTTTATCCTCCTCTTCTACCTCGTT
TTTTATGGGTTCCTCACCGCCATGTTCACCCTCACCATGTGGGTGATGCTGCAGACTGTCTCCGACCAT
ACCCCCAAGTACCAGGACCGACTGGCCACACCGGGCTTGATGATTCGCCCCAAGACTGAGAACCTTGAT
GTCATTGTCAATGTCAGTGACACTGAAAGCTGGGACCAGCATGTTCAGAAGCTCAACAAGTTCTTGGAG
CCTTACAACGACTCTATCCAAGCCCAAAAGAATGATGTCTGCCGCCCTGGACGCTATTACGAACAGCCA
GATAATGGAGTCCTCAACTACCCCAAACGTGCCTGCCAATTCAACCGGACCCAGCTGGGCAACTGCTCC
GGCATTGGGGACTCCACCCACTATGGTTACAGCACTGGGCAGCCCTGTGTCTTCATCAAGATGAACCGG
GTCATCAACTTCTATGCAGGAGCAAACCAGAGCATGAATGTTACCTGTGCTGGGAAGCGAGATGAAGAT
GCTGAGAATCTCGGCAACTTCGTCATGTTCCCCGCCAACGGCAACATCGACCTCATGTACTTCCCCTAC
TATGGCAAAAAGTTCCACGTGAACTACACACAGCCCCTGGTGGCTGTGAAGTTCCTGAATGTGACCCCC
AACGTGGAGGTGAATGTAGAATGTCGCATCAACGCCGCCAACATCGCCACAGACGATGAGCGAGACAAG
TTCGCCGGCCGCGTGGCCTTCAAACTCCGCATCAACAAAACCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001678
Insert Size 873 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001678.4
RefSeq Size 3396 bp
RefSeq ORF 873 bp
Locus ID 482
UniProt ID P14415
Cytogenetics 17p13.1
Domains Na_K-ATPase
Protein Families Transmembrane
Protein Pathways Cardiac muscle contraction
MW 33.4 kDa
Summary The protein encoded by this gene belongs to the family of Na+/K+ and H+/K+ ATPases beta chain proteins, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The beta subunit regulates, through assembly of alpha/beta heterodimers, the number of sodium pumps transported to the plasma membrane. The glycoprotein subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes a beta 2 subunit. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2014]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:ATP1B2 (NM_001678) Human Untagged Clone
Your Rating
SKU Description Size Price
RC220004 ATP1B2 (Myc-DDK-tagged)-Human ATPase, Na+/K+ transporting, beta 2 polypeptide (ATP1B2) 10 ug
$300.00
RC220004L1 Lenti ORF clone of Human ATPase, Na+/K+ transporting, beta 2 polypeptide (ATP1B2), Myc-DDK-tagged 10 ug
$600.00
RC220004L2 Lenti ORF clone of Human ATPase, Na+/K+ transporting, beta 2 polypeptide (ATP1B2), mGFP tagged 10 ug
$600.00
RC220004L3 Lenti ORF clone of Human ATPase, Na+/K+ transporting, beta 2 polypeptide (ATP1B2), Myc-DDK-tagged 10 ug
$600.00
RC220004L4 Lenti ORF clone of Human ATPase, Na+/K+ transporting, beta 2 polypeptide (ATP1B2), mGFP tagged 10 ug
$600.00
RG220004 ATP1B2 (tGFP-tagged) - Human ATPase, Na+/K+ transporting, beta 2 polypeptide (ATP1B2) 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.