Cyclin Y (CCNY) (NM_181698) Human Untagged Clone

SKU
SC312811
CCNY (untagged)-Human cyclin Y (CCNY), transcript variant 2
$480.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Cyclin Y
Synonyms C10orf9; CBCP1; CCNX; CFP1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC312811 representing NM_181698.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAATTCAATCCTTCAGATCATCCTCGGGCCAGCACAATATTCCTCAGTAAATCTCAGACGGACGTG
AGAGAAAAACGCAAGAGTCTCTTCATTAACCATCATCCTCCAGGACAAATAGCAAGGAAATACAGTTCC
TGCTCCACCATTTTCCTAGATGATAGCACAGTCAGTCAACCAAACCTCAAGTATACAATTAAATGTGTC
GCTCTTGCAATATATTATCACATCAAAAACAGGGACCCAGATGGAAGGATGCTCTTAGATATTTTTGAT
GAAAATCTTCACCCTCTTTCGAAATCCGAAGTGCCACCAGATTATGACAAACACAACCCAGAGCAGAAG
CAGATTTACCGGTTCGTTCGGACACTGTTCAGTGCTGCTCAGCTGACGGCTGAATGTGCCATCGTCACC
CTGGTGTACCTTGAAAGACTTTTAACATACGCAGAGATAGATATCTGTCCGGCCAACTGGAAGCGGATT
GTTTTAGGGGCGATCCTGCTGGCCTCCAAGGTGTGGGATGACCAGGCTGTATGGAATGTGGATTACTGC
CAGATCCTGAAAGACATCACGGTGGAGGACATGAACGAGCTAGAGCGACAGTTTCTTGAATTGCTGCAG
TTCAACATCAATGTTCCTTCCAGTGTCTATGCCAAGTATTATTTTGATCTTCGTTCTCTGGCAGAAGCG
AACAACCTGAGCTTTCCCTTGGAGCCCCTGAGCAGGGAGAGGGCTCACAAGCTTGAGGCCATCTCTCGC
CTCTGCGAGGACAAGTACAAGGACCTAAGAAGATCCGCGAGGAAGCGCTCAGCCAGTGCAGACAACCTG
ACTCTGCCCCGGTGGTCCCCAGCCATCATCTCTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_181698
Insert Size 864 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_181698.3
RefSeq Size 4735 bp
RefSeq ORF 864 bp
Locus ID 219771
UniProt ID Q8ND76
Cytogenetics 10p11.21
MW 33.2 kDa
Summary Cyclins, such as CCNY, control cell division cycles and regulate cyclin-dependent kinases (e.g., CDC2; MIM 116940) (Li et al., 2009 [PubMed 18060517]).[supplied by OMIM, May 2009]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream start codon, compared to variant 1. Variants 2 and 4 encode the same isoform (2), which has a shorter N-terminus than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:Cyclin Y (CCNY) (NM_181698) Human Untagged Clone
Your Rating
SKU Description Size Price
RC220991 CCNY (Myc-DDK-tagged)-Human cyclin Y (CCNY), transcript variant 2 10 ug
$732.00
RC220991L3 Lenti-ORF clone of CCNY (Myc-DDK-tagged)-Human cyclin Y (CCNY), transcript variant 2 10 ug
$1,032.00
RC220991L4 Lenti-ORF clone of CCNY (mGFP-tagged)-Human cyclin Y (CCNY), transcript variant 2 10 ug
$1,032.00
RG220991 CCNY (tGFP-tagged) - Human cyclin Y (CCNY), transcript variant 2 10 ug
$932.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.