TNFAIP8 (NM_014350) Human Untagged Clone

SKU
SC312385
TNFAIP8 (untagged)-Human tumor necrosis factor, alpha-induced protein 8 (TNFAIP8), transcript variant 1
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol TNFAIP8
Synonyms GG2-1; MDC-3.13; NDED; SCC-S2; SCCS2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC312385 representing NM_014350.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCACTCCGAAGCAGAAGAATCCAAGGAAGTGGCCACAGATGTCTTTAATTCCAAAAACCTGGCCGTT
CAGGCACAAAAGAAGATCTTGGGTAAAATGGTGTCCAAATCCATCGCCACCACCTTAATAGACGACACA
AGTAGTGAGGTGCTGGATGAGCTCTACAGAGTGACCAGGGAGTACACCCAAAACAAGAAGGAGGCAGAG
AAGATCATCAAGAACCTCATCAAGACAGTCATCAAGCTGGCCATTCTTTATAGGAATAATCAGTTTAAT
CAAGATGAGCTAGCATTGATGGAGAAATTTAAGAAGAAAGTTCATCAGCTTGCTATGACCGTGGTCAGT
TTCCATCAGGTGGATTATACCTTTGACCGGAATGTGTTATCCAGGCTGTTAAATGAATGCAGAGAGATG
CTGCACCAAATCATTCAGCGCCACCTCACTGCCAAGTCACATGGACGGGTTAATAATGTGTTTGATCAT
TTTTCAGATTGTGAATTTTTGGCTGCCTTGTATAATCCTTTTGGGAATTTTAAACCCCACTTACAAAAA
CTATGTGATGGTATCAACAAAATGTTGGATGAAGAGAACATATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_014350
Insert Size 597 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_014350.3
RefSeq Size 2103 bp
RefSeq ORF 597 bp
Locus ID 25816
UniProt ID O95379
Cytogenetics 5q23.1
Protein Families Druggable Genome
MW 23 kDa
Summary Acts as a negative mediator of apoptosis and may play a role in tumor progression. Suppresses the TNF-mediated apoptosis by inhibiting caspase-8 activity but not the processing of procaspase-8, subsequently resulting in inhibition of BID cleavage and caspase-3 activation.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes isoform a. Both variant 1 and 3 encode the same isoform.
Write Your Own Review
You're reviewing:TNFAIP8 (NM_014350) Human Untagged Clone
Your Rating
SKU Description Size Price
RC202729 TNFAIP8 (Myc-DDK-tagged)-Human tumor necrosis factor, alpha-induced protein 8 (TNFAIP8), transcript variant 1 10 ug
$300.00
RC202729L1 Lenti ORF clone of Human tumor necrosis factor, alpha-induced protein 8 (TNFAIP8), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC202729L2 Lenti ORF clone of Human tumor necrosis factor, alpha-induced protein 8 (TNFAIP8), transcript variant 1, mGFP tagged 10 ug
$600.00
RC202729L3 Lenti ORF clone of Human tumor necrosis factor, alpha-induced protein 8 (TNFAIP8), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC202729L4 Lenti ORF clone of Human tumor necrosis factor, alpha-induced protein 8 (TNFAIP8), transcript variant 1, mGFP tagged 10 ug
$600.00
RG202729 TNFAIP8 (tGFP-tagged) - Human tumor necrosis factor, alpha-induced protein 8 (TNFAIP8), transcript variant 1 10 ug
$489.00 MSRP $500.00 MSRP $500.00
SC317294 TNFAIP8 (untagged)-Human tumor necrosis factor, alpha-induced protein 8 (TNFAIP8), transcript variant 1 10 ug
$330.00
SC320774 TNFAIP8 (untagged)-Human tumor necrosis factor, alpha-induced protein 8 (TNFAIP8), transcript variant 1 10 ug
$300.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.