AP2 gamma (TFAP2C) (NM_003222) Human Untagged Clone

SKU
SC311381
TFAP2C (untagged)-Human transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma) (TFAP2C)
$686.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol AP2 gamma
Synonyms AP2-GAMMA; ERF1; hAP-2g; TFAP2G
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC311381 representing NM_003222.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTTGTGGAAAATAACCGATAATGTCAAGTACGAAGAGGACTGCGAGGATCGCCACGACGGGAGCAGC
AATGGGAATCCGCGGGTCCCCCACCTCTCCTCCGCCGGGCAGCACCTCTACAGCCCCGCGCCACCCCTC
TCCCACACTGGAGTCGCCGAATATCAGCCGCCACCCTACTTTCCCCCTCCCTACCAGCAGCTGGCCTAC
TCCCAGTCGGCCGACCCCTACTCGCATCTGGGGGAAGCGTACGCCGCCGCCATCAACCCCCTGCACCAG
CCGGCGCCCACAGGCAGCCAGCAGCAGGCCTGGCCCGGCCGCCAGAGCCAGGAGGGAGCGGGGCTGCCC
TCGCACCACGGGCGCCCGGCCGGCCTACTGCCCCACCTCTCCGGGCTGGAGGCGGGCGCGGTGAGCGCC
CGCAGGGATGCCTACCGCCGCTCCGACCTGCTGCTGCCCCACGCACACGCCCTGGATGCCGCGGGCCTG
GCCGAGAACCTGGGGCTCCACGACATGCCTCACCAGATGGACGAGGTGCAGAATGTCGACGACCAGCAC
CTGTTGCTGCACGATCAGACAGTCATTCGCAAAGGTCCCATTTCCATGACCAAGAACCCTCTGAACCTC
CCCTGTCAGAAGGAGCTGGTGGGGGCCGTAATGAACCCCACTGAGGTCTTCTGCTCAGTCCCTGGAAGA
TTGTCGCTCCTCAGCTCTACGTCTAAATACAAAGTGACAGTGGCTGAAGTACAGAGGCGACTGTCCCCA
CCTGAATGCTTAAATGCCTCGTTACTGGGAGGTGTTCTCAGAAGAGCCAAATCGAAAAATGGAGGCCGG
TCCTTGCGGGAGAAGTTGGACAAGATTGGGTTGAATCTTCCGGCCGGGAGGCGGAAAGCCGCTCATGTG
ACTCTCCTGACATCCTTAGTAGAAGGTGAAGCTGTTCATTTGGCTAGGGACTTTGCCTATGTCTGTGAA
GCCGAATTTCCTAGTAAACCAGTGGCAGAATATTTAACCAGACCTCATCTTGGAGGACGAAATGAGATG
GCAGCTAGGAAGAACATGCTATTGGCGGCCCAGCAACTGTGTAAAGAATTCACAGAACTTCTCAGCCAA
GACCGGACACCCCATGGGACCAGCAGGCTCGCCCCAGTCTTGGAGACGAACATACAGAACTGCTTGTCT
CATTTCAGCCTGATTACCCACGGGTTTGGCAGCCAGGCCATCTGTGCCGCGGTGTCTGCCCTGCAGAAC
TACATCAAAGAAGCCCTGATTGTCATAGACAAATCCTACATGAACCCTGGAGACCAGAGTCCAGCTGAT
TCTAACAAAACCCTGGAGAAAATGGAGAAACACAGGAAATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_003222
Insert Size 1353 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_003222.3
RefSeq Size 2895 bp
RefSeq ORF 1353 bp
Locus ID 7022
UniProt ID Q92754
Cytogenetics 20q13.31
Domains TF_AP-2
Protein Families Druggable Genome, Transcription Factors
MW 49.2 kDa
Summary The protein encoded by this gene is a sequence-specific DNA-binding transcription factor involved in the activation of several developmental genes. The encoded protein can act as either a homodimer or heterodimer with other family members and is induced during retinoic acid-mediated differentiation. It plays a role in the development of the eyes, face, body wall, limbs, and neural tube. [provided by RefSeq, Jul 2008]
Write Your Own Review
You're reviewing:AP2 gamma (TFAP2C) (NM_003222) Human Untagged Clone
Your Rating
SKU Description Size Price
RC208665 TFAP2C (Myc-DDK-tagged)-Human transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma) (TFAP2C) 10 ug
$686.00
RC208665L1 Lenti ORF clone of Human transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma) (TFAP2C), Myc-DDK-tagged 10 ug
$986.00
RC208665L2 Lenti ORF clone of Human transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma) (TFAP2C), mGFP tagged 10 ug
$986.00
RC208665L3 Lenti ORF clone of Human transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma) (TFAP2C), Myc-DDK-tagged 10 ug
$986.00
RC208665L4 Lenti ORF clone of Human transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma) (TFAP2C), mGFP tagged 10 ug
$986.00
RG208665 TFAP2C (tGFP-tagged) - Human transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma) (TFAP2C) 10 ug
$886.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.