FEZ2 (NM_001042548) Human Untagged Clone

SKU
SC311373
FEZ2 (untagged)-Human fasciculation and elongation protein zeta 2 (zygin II) (FEZ2), transcript variant 2
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol FEZ2
Synonyms HUM3CL
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC311373 representing NM_001042548.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGCGGACGGGGACTGGCAGGATTTCTATGAGTTCCAGGAGCCGGCCCGGAGCCTCCTGGACCAG
GAGAACTGTAACGCGAGCCCCGAGCCTGGGGCGGAGGCGGGGGCCGAGGCGGGTGGGGGCGCCGACGGT
TTCCCGGCCCCGGCCTGCAGCTTGGAGGAGAAGCTGAGCCTGTGCTTCCGCCCCTCGGATCCGGGCGCC
GAGCCCCCGAGGACGGCCGTGCGGCCCATCACGGAGCGCAGCCTCCTGCAGGGGGACGAGATTTGGAAT
GCCCTGACAGATAATTATGGGAATGTGATGCCTGTAGACTGGAAGTCATCGCATACTAGGACCTTGCAC
TTGCTTACTCTGAACCTCTCAGAAAAAGGGGTAAGTGACAGTTTGCTCTTTGATACATCAGATGATGAA
GAGCTGAGAGAACAGCTGGATATGCACTCAATCATCGTCTCCTGTGTTAATGATGAACCCCTCTTCACG
GCAGACCAGGTTATTGAAGAAATTGAAGAAATGATGCAGGAATCACCGGACCCAGAAGATGATGAAACC
CCTACACAGTCAGATCGGCTTTCAATGCTTTCCCAGGAAATTCAAACTCTCAAGAGGTCTAGTACCGGC
AGTTATGAAGAGAGAGTGAAAAGGCTCTCAGTGTCTGAGTTAAATGAAATCCTGGAAGAAATTGAGACT
GCCATTAAGGAGTACTCTGAGGAGCTGGTGCAGCAGTTGGCTTTACGAGATGAACTGGAGTTTGAAAAG
GAAGTGAAAAACAGCTTTATTTCTGTTCTTATTGAAGTGCAAAACAAACAGAAAGAGCACAAAGAAACA
GCAAAAAAGAAAAAGAAACTAAAAAATGGCAGCTCTCAGAATGGGAAGAATGAGAGAAGTCATATGCCC
GGCACACGCTTCAGCATGGAAGGGATCTCAAATGTCATTCAGAATGGCCTCCGCCACACCTTTGGAAAT
TCAGGTGGAGAGAAACAGTATTTGACTACAGTCATTCCTTATGAGAAAAAAAACGGACCACCGTCTGTT
GAAGATCTTCAAATATTAACAAAAATTCTTCGTGCCATGAAGGAGGACAGTGAAAAAGTTCCGAGCTTG
TTAACTGATTATATTCTGAAAGTTCTGTGTCCTACATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001042548
Insert Size 1143 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001042548.1
RefSeq Size 2110 bp
RefSeq ORF 1143 bp
Locus ID 9637
UniProt ID Q9UHY8
Cytogenetics 2p22.2
MW 42.6 kDa
Summary This gene is an ortholog of the C. elegans unc-76 gene, which is necessary for normal axonal bundling and elongation within axon bundles. Other orthologs include the rat gene that encodes zygin II, which can bind to synaptotagmin. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) includes an alternate in-frame exon, compared to variant 1, resulting in a longer protein isoform.
Write Your Own Review
You're reviewing:FEZ2 (NM_001042548) Human Untagged Clone
Your Rating
SKU Description Size Price
RC217477 FEZ2 (Myc-DDK-tagged)-Human fasciculation and elongation protein zeta 2 (zygin II) (FEZ2), transcript variant 2 10 ug
$457.00
RC217477L1 Lenti ORF clone of Human fasciculation and elongation protein zeta 2 (zygin II) (FEZ2), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC217477L2 Lenti ORF clone of Human fasciculation and elongation protein zeta 2 (zygin II) (FEZ2), transcript variant 2, mGFP tagged 10 ug
$757.00
RC217477L3 Lenti ORF clone of Human fasciculation and elongation protein zeta 2 (zygin II) (FEZ2), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC217477L4 Lenti ORF clone of Human fasciculation and elongation protein zeta 2 (zygin II) (FEZ2), transcript variant 2, mGFP tagged 10 ug
$757.00
RG217477 FEZ2 (tGFP-tagged) - Human fasciculation and elongation protein zeta 2 (zygin II) (FEZ2), transcript variant 2 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.