CAPSL (NM_001042625) Human Untagged Clone

SKU
SC311348
CAPSL (untagged)-Human calcyphosine-like (CAPSL), transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CAPSL
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC311348 representing NM_001042625.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCAGGGACAGCGCGCCATGACCGAGAGATGGCGATCCAGGCCAAGAAAAAGCTCACCACGGCCACC
GACCCCATTGAAAGACTCCGACTGCAGTGCCTGGCCAGGGGCTCTGCTGGGATCAAAGGACTTGGCAGA
GTGTTTAGAATTATGGATGACGATAATAATCGAACCCTTGATTTTAAAGAATTTATGAAAGGGTTAAAT
GATTATGCTGTGGTCATGGAAAAAGAAGAGGTGGAAGAACTTTTCCGGAGGTTTGATAAAGATGGAAAT
GGAACAATAGACTTCAATGAATTTCTTCTCACATTAAGACCTCCAATGTCCAGAGCCAGAAAAGAGGTA
ATCATGCAAGCTTTTAGAAAGTTAGACAAGACTGGAGATGGTGTTATAACAATCGAAGACCTTCGTGAA
GTATATAATGCAAAACACCACCCAAAGTACCAGAATGGGGAATGGAGTGAGGAACAAGTATTTAGGAAA
TTTCTGGATAACTTTGATTCACCCTATGACAAAGATGGATTGGTGACCCCTGAGGAGTTCATGAACTAC
TATGCAGGTGTGAGCGCATCCATTGACACTGATGTGTACTTCATCATCATGATGAGAACCGCCTGGAAG
CTTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001042625
Insert Size 627 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001042625.1
RefSeq Size 987 bp
RefSeq ORF 627 bp
Locus ID 133690
UniProt ID Q8WWF8
Cytogenetics 5p13.2
MW 24.2 kDa
Write Your Own Review
You're reviewing:CAPSL (NM_001042625) Human Untagged Clone
Your Rating
SKU Description Size Price
RC205410 CAPSL (Myc-DDK-tagged)-Human calcyphosine-like (CAPSL), transcript variant 2 10 ug
$300.00
RC205410L3 Lenti ORF clone of Human calcyphosine-like (CAPSL), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC205410L4 Lenti ORF clone of Human calcyphosine-like (CAPSL), transcript variant 2, mGFP tagged 10 ug
$600.00
RG205410 CAPSL (tGFP-tagged) - Human calcyphosine-like (CAPSL), transcript variant 2 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.