ABHD12 (NM_001042472) Human Untagged Clone

SKU
SC311263
ABHD12 (untagged)-Human abhydrolase domain containing 12 (ABHD12), transcript variant 1
$457.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol ABHD12
Synonyms ABHD12A; BEM46L2; C20orf22; dJ965G21.2; hABHD12; PHARC
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001042472 edited
ATGAGGAAGCGGACCGAGCCCGTCGCCTTGGAGCATGAGCGCTGCGCCGCCGCGGGCTCG
TCCTCCTCCGGCTCGGCCGCCGCGGCGCTGGACGCCGACTGCCGCCTGAAGCAGAACCTA
CGCCTGACGGGCCCGGCGGCGGCTGAGCCGCGCTGCGCAGCCGACGCGGGAATGAAGCGG
GCGCTGGGCAGGCGAAAGGGCGTGTGGTTGCGCCTGAGGAAGATACTTTTCTGTGTTTTG
GGGTTGTACATTGCCATTCCATTTCTCATCAAACTATGTCCTGGAATACAGGCCAAACTG
ATTTTCTTGAATTTCGTAAGAGTTCCCTATTTCATTGATTTGAAAAAACCACAGGATCAA
GGTTTGAATCACACGTGTAACTACTACCTGCAGCCAGAGGAAGACGTGACCATTGGAGTC
TGGCACACCGTCCCTGCAGTCTGGTGGAAGAACGCCCAAGGCAAAGACCAGATGTGGTAT
GAGGATGCCTTGGCTTCCAGCCACCCTATCATTCTGTACCTGCATGGGAACGCAGGTACC
AGAGGAGGCGACCACCGCGTGGAGCTTTACAAGGTGCTGAGTTCCCTTGGTTACCATGTG
GTCACCTTTGACTACAGAGGTTGGGGTGACTCAGTGGGAACGCCATCTGAGCGGGGCATG
ACCTATGACGCACTCCACGTTTTTGACTGGATCAAAGCAAGAAGTGGTGACAACCCCGTG
TACATCTGGGGCCACTCTCTGGGCACTGGCGTGGCGACAAATCTGGTGCGGCGCCTCTGT
GAGCGAGAGACGCCTCCAGATGCCCTTATATTGGAATCTCCATTCACTAATATCCGTGAA
GAAGCTAAGAGCCATCCATTTTCAGTGATATATCGATACTTCCCTGGGTTTGACTGGTTC
TTCCTTGATCCTATTACAAGTAGTGGAATTAAATTTGCAAATGATGAAAACGTGAAGCAC
ATCTCCTGTCCCCTGCTCATCCTGCACGCTGAGGACGACCCGGTGGTGCCCTTCCAGCTT
GGCAGAAAGCTCTATAGCATCGCCGCACCAGCTCGAAGCTTCCGAGATTTCAAAGTTCAG
TTTGTGCCCTTTCATTCAGACCTTGGCTACAGGCACAAATACATTTACAAGAGCCCTGAG
CTGCCACGGATACTGAGGGAATTCCTGGGGAAGTCGGAGCCTGAGCACCAGCACTGA
Restriction Sites Please inquire
ACCN NM_001042472
Insert Size 1200 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001042472.1, NP_001035937.1
RefSeq Size 1983 bp
RefSeq ORF 1197 bp
Locus ID 26090
UniProt ID Q8N2K0
Cytogenetics 20p11.21
Protein Families Protease, Transmembrane
Summary This gene encodes an enzyme that catalyzes the hydrolysis of 2-arachidonoyl glycerol (2-AG), the main endocannabinoid lipid transmitter that acts on cannabinoid receptors, CB1 and CB2. The endocannabinoid system is involved in a wide range of physiological processes, including neurotransmission, mood, appetite, pain appreciation, addiction behavior, and inflammation. Mutations in this gene are associated with the neurodegenerative disease, PHARC (polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, and cataract), resulting from an inborn error of endocannabinoid metabolism. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Jan 2011]
Transcript Variant: This variant (1) represents the predominant transcript and encodes the shorter isoform (a).
Write Your Own Review
You're reviewing:ABHD12 (NM_001042472) Human Untagged Clone
Your Rating
SKU Description Size Price
RC216963 ABHD12 (Myc-DDK-tagged)-Human abhydrolase domain containing 12 (ABHD12), transcript variant 1 10 ug
$457.00
RC216963L1 Lenti ORF clone of Human abhydrolase domain containing 12 (ABHD12), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC216963L2 Lenti ORF clone of Human abhydrolase domain containing 12 (ABHD12), transcript variant 1, mGFP tagged 10 ug
$757.00
RC216963L3 Lenti ORF clone of Human abhydrolase domain containing 12 (ABHD12), transcript variant 1, Myc-DDK-tagged 10 ug
$757.00
RC216963L4 Lenti ORF clone of Human abhydrolase domain containing 12 (ABHD12), transcript variant 1, mGFP tagged 10 ug
$757.00
RG216963 ABHD12 (tGFP-tagged) - Human abhydrolase domain containing 12 (ABHD12), transcript variant 1 10 ug
$489.00 MSRP $657.00 MSRP $657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.