HMGCLL1 (NM_001042406) Human Untagged Clone

SKU
SC311258
HMGCLL1 (untagged)-Human 3-hydroxymethyl-3-methylglutaryl-CoA lyase-like 1 (HMGCLL1), transcript variant 2
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol HMGCLL1
Synonyms bA418P12.1; er-cHL
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC311258 representing NM_001042406.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGGAATGTGCCATCCGCGGTGAAGCACTGCCTCAGCTACCAGCAGCTTCTCCGGGAGCATCTCTGG
ATCGGGGATTCAGTGGCAGGGGCGCTCGACCCCGCGCAGGAAACATCCCAGTTATCTGGACTCCCTGAG
TTTGTTAAAATAGTAGAAGTTGGGCCTAGGGATGGATTGCAGAATGAAAAGGTTATAGTTCCTACAGAT
ATAAAAATTGAATTTATCAATCGACTTTCCCAAACTGGCTTGTCTGTAATAGAAGTGACTAGCTTTGTG
TCTTCCAGATGGGTACCACAGATGGCTGATCACACTGAAGTAATGAAAGGCATTCATCAATATCCAGGA
GTTCGCTATCCTGTCCTTACTCCTAATCTTCAGGGTTTTCACCATGCTGTTGCTGCTGGAGCTACTGAG
ATATCAGTTTTTGGAGCTGCATCTGAATCCTTTAGCAAGAAGAATATTAACTGTTCCATTGAAGAAAGT
ATGGGAAAATTTGAGGAGGTTGTTAAGTCTGCAAGACACATGAATATTCCAGCACGAGGGTATGTGTCT
TGTGCTCTGGGCTGTCCATATGAAGGAAGTATTACACCGCAAAAAGTGACAGAAGTGTCTAAGAGATTG
TACGGCATGGGTTGTTATGAGATCTCTCTAGGAGACACAATTGGAGTGGGAACTCCAGGAAGTATGAAA
AGAATGTTGGAAAGTGTGATGAAAGAAATCCCACCAGGTGCTCTTGCTGTTCACTGTCATGACACATAC
GGACAAGCCTTAGCAAATATCCTTACGGCCCTTCAGATGGGAATTAATGTGGTGGACTCCGCAGTATCC
GGATTAGGTGGCTGCCCTTATGCAAAAGGTGCTTCTGGGAATGTAGCCACTGAGGATTTGATATATATG
CTTAATGGCCTGGGGCTCAATACAGGTGTGAATCTATACAAAGTGATGGAAGCTGGTGACTTTATTTGC
AAAGCTGTGAATAAAACCACAAACTCTAAAGTAGCACAAGCCTCCTTCAATGCTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001042406
Insert Size 1023 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001042406.1
RefSeq Size 2481 bp
RefSeq ORF 1023 bp
Locus ID 54511
UniProt ID Q8TB92
Cytogenetics 6p12.1
MW 36.3 kDa
Summary Non-mitochondrial 3-hydroxymethyl-3-methylglutaryl-CoA lyase that catalyzes a cation-dependent cleavage of (S)-3-hydroxy-3-methylglutaryl-CoA into acetyl-CoA and acetoacetate, a key step in ketogenesis, the products of which support energy production in nonhepatic animal tissues.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 5' coding region, compared to variant 1. It encodes isoform b, which is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:HMGCLL1 (NM_001042406) Human Untagged Clone
Your Rating
SKU Description Size Price
RC206162 HMGCLL1 (Myc-DDK-tagged)-Human 3-hydroxymethyl-3-methylglutaryl-CoA lyase-like 1 (HMGCLL1), transcript variant 2 10 ug
$457.00
RC206162L3 Lenti ORF clone of Human 3-hydroxymethyl-3-methylglutaryl-CoA lyase-like 1 (HMGCLL1), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC206162L4 Lenti ORF clone of Human 3-hydroxymethyl-3-methylglutaryl-CoA lyase-like 1 (HMGCLL1), transcript variant 2, mGFP tagged 10 ug
$757.00
RG206162 HMGCLL1 (tGFP-tagged) - Human 3-hydroxymethyl-3-methylglutaryl-CoA lyase-like 1 (HMGCLL1), transcript variant 2 10 ug
$489.00 MSRP $657.00 MSRP $657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.