PTPN20B (PTPN20) (NM_001042363) Human Untagged Clone

SKU
SC311256
PTPN20B (untagged)-Human protein tyrosine phosphatase, non-receptor type 20B (PTPN20B), transcript variant 8
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PTPN20B
Synonyms bA42B19.1; bA142I17.1; CT126; PTPN20A; PTPN20B
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC311256 representing NM_001042363.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTGGACAGCCAGAGGCCCCTTCAGAAGAGACAGGTGGAGCAGTGAGGATGAGGAGGCTGCAGGGCCA
TCACAGGCTCTCTCCCCTCTACTTTCTGATACGCGCAAAATTGTTTCTGAAGGAGAACTAGATCAGTTG
GCTCAGATTCGGCCATTAATATTCAATTTTCATGAGCAGACAGCCATCAAGGATTGTTTGAAAATCCTT
GAGGAAAAAACAGCAGCGTATGATATCATGCAGGAATTTATGGCTTTAGAACTTAAGAATCTGCCTGGT
GAGTTCAACTCTGGGAATCAACCAAGCAACAGAGAAAAAAATAGATACCGAGATATTCTTCCATATGAT
TCAACACGCGTTCCTCTTGGAAAAAGCAAGGACTACATCAATGCTAGTTATATTAGAATAGTCAATTGT
GGAGAAGAGTATTTTTATATCGCTACTCAAGGACCACTGCTGAGCACCATAGATGACTTTTGGCAAATG
GTGTTGGAAAATAATTCAAATGTTATTGCCATGATAACCAGAGAGATAGAAGGTGGAATTATCAAATGC
TACCATTACTGGCCCATTTCTCTGAAGAAGCCATTGGAATTGAAACACTTCCGTGTATTCCTGGAGAAC
TACCAGATACTTCAATATTTCATCATTCGAATGTTTCAAGTTGTGGAGAAGTCCACGGGAACTAGTCAC
TCTGTAAAACAGTTGCAGTTCACCAAGTGGCCAGACCATGGCACTCCTGCCTCAGCAGATAGCTTCATA
AAATATATTCGTTATGCAAGGAAGAGCCACCTTACAGGACCCATGGTTGTTCACTGCAGTGCCGGCATA
GGCCGGACAGGGGTGTTCCTATGTGTGGATGTCGTGTTCTGTGCCATCGTAAAGAACTGTTCATTCAAC
ATCATGGATATAGTGGCCCAAATGAGAGAACAACGTTCTGGCATGGTTCAAACGAAGGAGCAGTATCAC
TTTTGTTACGATATTGTGCTTGAAGTTCTTCGGAAACTTCTGACTTTGGATTAA

AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGAT
ATCCTGGATTACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-RsrII
ACCN NM_001042363
Insert Size 1020 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001042363.4
RefSeq Size 2930 bp
RefSeq ORF 1020 bp
Locus ID 26095
UniProt ID Q4JDL3
Cytogenetics 10q11.22
Protein Families Druggable Genome, Phosphatase
MW 39.2 kDa
Summary The product of this gene belongs to the family of classical tyrosine-specific protein tyrosine phosphatases. Many protein tyrosine phosphatases have been shown to regulate fundamental cellular processes. The encoded protein appears to be targeted to sites of actin polymerization. A pseudogene of this gene has been defined on chromosome 10. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
Transcript Variant: This variant (8) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start site compared to variant 1. The encoded isoform (8) has a shorter N-terminus compared to isoform 1. Variants 8, 11, and 12 all encode the same isoform (8).
Write Your Own Review
You're reviewing:PTPN20B (PTPN20) (NM_001042363) Human Untagged Clone
Your Rating
SKU Description Size Price
RC212878 PTPN20B (Myc-DDK-tagged)-Human protein tyrosine phosphatase, non-receptor type 20B (PTPN20B), transcript variant 8 10 ug
$457.00
RC212878L3 Lenti ORF clone of Human protein tyrosine phosphatase, non-receptor type 20B (PTPN20B), transcript variant 8, Myc-DDK-tagged 10 ug
$757.00
RC212878L4 Lenti ORF clone of Human protein tyrosine phosphatase, non-receptor type 20B (PTPN20B), transcript variant 8, mGFP tagged 10 ug
$757.00
RG212878 PTPN20B (tGFP-tagged) - Human protein tyrosine phosphatase, non-receptor type 20B (PTPN20B), transcript variant 8 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.