VAMP1 (NM_014231) Human Untagged Clone

SKU SC311201

VAMP1 (untagged)-Human vesicle-associated membrane protein 1 (synaptobrevin 1) (VAMP1), transcript variant 1

Product Data

• Type: Human Untagged Clone
• Target Symbol: VAMP1
• Synonyms: CMS25; SPAX1; SYB1; VAMP-1
• Vector: pCMV6-XL4
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_014231 edited; CACTGAAGGATCCTCACAGCAACCGCTCCTTTCCGGAGTCGGATGAGAGGAGAGTTGTGA; CTGGCAATTGGCAGGGGCGGGGCGGGCTAGGCCTGTAGCGCTGGGCGACCGTCCTGGGCA; TGGATTGGGCCGCGGGGTTGTCACCGTTATCCGGGAGGCGTGGTCAGCACTAATAAAGGC; GGAGGCCGGCGCGGCAGCTGCAGTAAGTTCCAGCGCAGCTAGACCGCGGGGTAGTCGGCG; CGAGGCGGAGCTTGGCAGTTCCGTCCACTTCAGCCGCAGCGTCCCTCGCCGGGTGTCTCG; CCGCAGCCTCCGGAGAGGAACAGACCCTCACTCTCTCTGTCAGAAAAATGTCTGCTCCAG; CTCAGCCACCTGCTGAAGGGACAGAAGGGACTGCCCCAGGTGGGGGTCCCCCTGGCCCTC; CTCCTAACATGACCAGTAACAGACGACTACAGCAAACCCAGGCACAAGTGGAGGAGGTGG; TGGACATCATACGTGTGAACGTGGACAAGGTCCTGGAGAGGGACCAGAAGCTGTCAGAGC; TGGATGACCGAGCTGATGCCTTGCAGGCAGGAGCATCACAATTTGAGAGCAGTGCTGCAA; AGCTAAAGAGGAAGTATTGGTGGAAAAACTGCAAGATGATGATCATGCTGGGAGCCATCT; GTGCCATCATCGTGGTAGTTATTGTAATCTACTTTTTTACTTGAGAATG;
• Restriction Sites: Please inquire
• ACCN: NM_014231
• Insert Size: 700 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_014231.3, NP_055046.1
• RefSeq Size: 2748 bp
• RefSeq ORF: 357 bp
• Locus ID: 6843
• UniProt ID: P23763
• Cytogenetics: 12p13.31
• Domains: synaptobrevin
• Protein Families: Secreted Protein, Transmembrane
• Protein Pathways: SNARE interactions in vesicular transport
• Summary: Synapotobrevins, syntaxins, and the synaptosomal-associated protein SNAP25 are the main components of a protein complex involved in the docking and/or fusion of synaptic vesicles with the presynaptic membrane. The protein encoded by this gene is a member of the vesicle-associated membrane protein (VAMP)/synaptobrevin family. Mutations in this gene are associated with autosomal dominant spastic ataxia 1. Multiple alternative splice variants have been described, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2014]; Transcript Variant: This variant (1), also known as VAMP-1A, encodes the longest isoform (1).