NCALD (NM_001040625) Human Untagged Clone

SKU
SC311190
NCALD (untagged)-Human neurocalcin delta (NCALD), transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol NCALD
Vector pCMV6 series
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001040625, the custom clone sequence may differ by one or more nucleotides
ATGGGGAAACAGAACAGCAAGCTGCGCCCGGAGGTCATGCAGGACTTGCTGGAAAGCACA
GACTTTACAGAGCATGAGATCCAGGAATGGTATAAAGGCTTCTTGAGAGACTGCCCCAGT
GGACATTTGTCAATGGAAGAGTTTAAGAAAATATATGGGAACTTTTTCCCTTATGGGGAT
GCTTCCAAATTTGCAGAGCATGTCTTCCGCACCTTCGATGCAAATGGAGATGGGACAATA
GACTTTAGAGAATTCATCATCGCCTTGAGTGTAACTTCGAGGGGGAAGCTGGAGCAGAAG
CTGAAATGGGCCTTCAGCATGTACGACCTGGACGGAAATGGCTATATCAGCAAGGCAGAG
ATGCTAGAGATCGTGCAGGCAATCTATAAGATGGTTTCCTCTGTAATGAAAATGCCTGAA
GATGAGTCAACCCCAGAGAAAAGAACAGAAAAGATCTTCCGCCAGATGGACACCAATAGA
GACGGAAAACTCTCCCTGGAAGAGTTCATCCGAGGAGCCAAAAGCGACCCGTCCATTGTG
CGCCTCCTGCAGTGCGACCCGAGCAGTGCCGGCCAGTTCTGA
Restriction Sites Please inquire
ACCN NM_001040625
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001040625.1, NP_001035715.1
RefSeq Size 3673 bp
RefSeq ORF 582 bp
Locus ID 83988
UniProt ID P61601
Cytogenetics 8q22.3
Summary This gene encodes a member of the neuronal calcium sensor (NCS) family of calcium-binding proteins. The protein contains an N-terminal myristoylation signal and four EF-hand calcium binding loops. The protein is cytosolic at resting calcium levels; however, elevated intracellular calcium levels induce a conformational change that exposes the myristoyl group, resulting in protein association with membranes and partial co-localization with the perinuclear trans-golgi network. The protein is thought to be a regulator of G protein-coupled receptor signal transduction. Several alternatively spliced variants of this gene have been determined, all of which encode the same protein; additional variants may exist but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks an exon in the 5' UTR compared to variant 1.
Write Your Own Review
You're reviewing:NCALD (NM_001040625) Human Untagged Clone
Your Rating
SKU Description Size Price
RC213925 NCALD (Myc-DDK-tagged)-Human neurocalcin delta (NCALD), transcript variant 2 10 ug
$300.00
RC213925L3 Lenti-ORF clone of NCALD (Myc-DDK-tagged)-Human neurocalcin delta (NCALD), transcript variant 2 10 ug
$600.00
RC213925L4 Lenti-ORF clone of NCALD (mGFP-tagged)-Human neurocalcin delta (NCALD), transcript variant 2 10 ug
$600.00
RG213925 NCALD (tGFP-tagged) - Human neurocalcin delta (NCALD), transcript variant 2 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.