CACNB4 (NM_000726) Human Untagged Clone

SKU
SC311158
CACNB4 (untagged)-Human calcium channel, voltage-dependent, beta 4 subunit (CACNB4), transcript variant 2
$485.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CACNB4
Synonyms CAB4; CACNLB4; EA5; EIG9; EJM; EJM4; EJM6
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_000726 edited
ATGTCCTCCTCCTCCTACGCCAAGAACGGGACCGCGGACGGGCCGCACTCCCCCACCTCG
CAGGTGGCCCGAGGCACCACAACCCGGAGGAGCAGGTTGAAAAGATCCGATGGCAGCACC
ACTTCGACCAGCTTCATCCTCAGACAGGGTTCAGCGGATTCCTACACAAGCAGGCCGTCT
GACTCCGATGTCTCTTTGGAAGAGGACCGGGAAGCAATTCGACAGGAGAGAGAACAGCAA
GCAGCTATCCAGCTTGAGAGAGCAAAGTCCAAACCTGTAGCATTTGCCGTGAAGACAAAT
GTGAGCTACTGCGGCGCCCTGGACGAGGATGTGCCTGTTCCAAGCACAGCTATCTCCTTT
GATGCTAAAGACTTTCTACATATTAAAGAGAAATATAACAATGATTGGTGGATAGGAAGG
CTGGTGAAAGAGGGCTGTGAAATTGGCTTCATTCCAAGTCCACTCAGATTGGAGAACATA
CGGATCCAGCAAGAACAAAAAAGAGGACGTTTTCACGGAGGGAAATCAAGTGGAAATTCT
TCTTCAAGTCTTGGAGAAATGGTATCTGGGACATTCCGAGCAACTCCCACATCAACAGCA
AAACAGAAGCAAAAAGTGACGGAGCACATTCCTCCTTACGATGTTGTACCGTCAATGCGT
CCGGTGGTGTTAGTGGGGCCGTCACTGAAAGGTTACGAGGTAACAGACATGATGCAGAAA
GCCCTCTTTGATTTCCTGAAGCACAGGTTTGATGGGAGGATTTCAATAACGAGAGTGACA
GCTGACATTTCTCTTGCTAAGAGGTCTGTCCTAAATAATCCCAGCAAGAGAGCAATAATT
GAACGTTCGAACACCCGGTCCAGCTTAGCGGAAGTACAAAGTGAAATTGAAAGAATCTTT
GAGTTGGCAAGATCTTTGCAACTGGTTGTTCTTGATGCAGACACCATCAATCACCCAGCA
CAACTTATAAAGACTTCCTTAGCACCAATTATTGTTCATGTAAAAGTCTCATCTCCAAAG
GTTTTACAGCGGTTGATTAAATCTAGAGGAAAGTCACAAAGTAAACACTTGAATGTTCAA
CTGGTGGCAGCTGATAAACTTGCACAATGCCCCCCAGAAATGTTTGATGTTATATTGGAT
GAAAATCAGCTTGAGGATGCATGTGAACATCTAGGGGAGTACCTGGAGGCGTACTGGCGT
GCCACCCACACAACCAGTAGCACACCCATGACCCCGCTGCTGGGAAGGAATTTGGGCTCC
ACGGCACTCTCACCATATCCCACAGCAATTTCTGGGTTACAGAGTCAGCGAATGAGGCAC
AGCAACCACTCCACAGAGAACTCTCCAATTGAAAGACGAAGTCTAATGACCTCTGATGAA
AATTATCACAATGAAAGGGCTCGGAAGAGTAGGAACCGCTTGTCTTCCAGTTCTCAGCAT
AGCCGAGATCATTACCCTCTTGTGGAAGAAGATTACCCTGACTCATACCAGGACACTTAC
AAACCCCATAGGAACCGAGGATCACCTGGGGGATATAGCCATGACTCCCGACATAGGCTT
TGA
Restriction Sites Please inquire
ACCN NM_000726
Insert Size 1600 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_000726.2, NP_000717.2
RefSeq Size 3079 bp
RefSeq ORF 1563 bp
Locus ID 785
UniProt ID O00305
Cytogenetics 2q23.3
Domains Ca_channel_B, GuKc, SH3
Protein Families Druggable Genome, Ion Channels: Other
Protein Pathways Arrhythmogenic right ventricular cardiomyopathy (ARVC), Cardiac muscle contraction, Dilated cardiomyopathy, Hypertrophic cardiomyopathy (HCM), MAPK signaling pathway
Summary This gene encodes a member of the beta subunit family of voltage-dependent calcium channel complex proteins. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. The protein encoded by this locus plays an important role in calcium channel function by modulating G protein inhibition, increasing peak calcium current, controlling the alpha-1 subunit membrane targeting and shifting the voltage dependence of activation and inactivation. Certain mutations in this gene have been associated with idiopathic generalized epilepsy (IGE), juvenile myoclonic epilepsy (JME), and episodic ataxia, type 5. [provided by RefSeq, Aug 2016]
Transcript Variant: This variant (2) encodes the longest isoform (b). This isoform has a b-type N-terminus. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:CACNB4 (NM_000726) Human Untagged Clone
Your Rating
SKU Description Size Price
RC210440 CACNB4 (Myc-DDK-tagged)-Human calcium channel, voltage-dependent, beta 4 subunit (CACNB4), transcript variant 2 10 ug
$484.00
RC210440L1 Lenti ORF clone of Human calcium channel, voltage-dependent, beta 4 subunit (CACNB4), transcript variant 2, Myc-DDK-tagged 10 ug
$784.00
RC210440L2 Lenti ORF clone of Human calcium channel, voltage-dependent, beta 4 subunit (CACNB4), transcript variant 2, mGFP tagged 10 ug
$784.00
RC210440L3 Lenti ORF clone of Human calcium channel, voltage-dependent, beta 4 subunit (CACNB4), transcript variant 2, Myc-DDK-tagged 10 ug
$784.00
RC210440L4 Lenti ORF clone of Human calcium channel, voltage-dependent, beta 4 subunit (CACNB4), transcript variant 2, mGFP tagged 10 ug
$784.00
RG210440 CACNB4 (tGFP-tagged) - Human calcium channel, voltage-dependent, beta 4 subunit (CACNB4), transcript variant 2 10 ug
$489.00 MSRP $684.00 MSRP $684.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.